pycom07g26530

Cyclic nucleotide-gated ion channel 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0000119
Physical Location & Seq
Reverse (-)
26519559 .. 26520610
1052 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g26530.2

Sequence Viewer

Length: 399 bp
ATGTCTGCGCGCTTGTGTGTTGTTGTATATGTAAATATGCTTAAGGATAGGGATGAAAAAGTGTTGACGTTGATATGCGACTGTCAGAAGCTAGTGACGTACAGTGAGAACACCTTTGTTTTTCGAATGGGAGATCCACTCGATTGCATGTTCATTATCAAAGGGACAATGTGGACCTACGCGTCATCGAGTGACGGGTGGGCCCAACGATCTAAGAATCCAACAAAAACTCGAACAAAAGTAGAAGCATTTGTGCTCATGTCCCAGGACTTGGAAACTGTAGTCTCCAGATGCAAACCATATTGGGAATGTAACAATCCTGAAGAGGTGGCACTTGCTACCATTCGTCGTTTCCGTACCAAGGCACAGCGACACGAGGTCCGTCCCCGGCTGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
Ion_trans

Protein Analysis

133

Amino Acids

15.42

Weight (kDa)

8.97

Isoelectric Point (pI)

37.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000119)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g10570 FvH4_4g36390 FvH4_7g31840 FvH4_7g31840 FvH4_7g31850 FvH4_7g31850 FvH4_7g31861 FvH4_7g31861 FvH4_7g31950
malus_domestica MD01G1054600.v1.1 MD01G1221100.v1.1 MD01G1221400.v1.1 MD01G1221600.v1.1 MD01G1221800.v1.1 MD01G1222000.v1.1 MD01G1222100.v1.1 MD07G1140800.v1.1 MD07G1291200.v1.1 MD07G1291400.v1.1 MD07G1291500.v1.1 MD07G1291700.v1.1 MD07G1292500.v1.1 MD07G1292700.v1.1 MD07G1292800.v1.1 MD07G1292900.v1.1 MD08G1241600.v1.1 MD11G1083800.v1.1 MD15G1431600.v1.1
prunus_persica Prupe.1G017800_v2.0.a1 Prupe.1G017800_v2.0.a1 Prupe.1G162800_v2.0.a1 Prupe.2G312500_v2.0.a1 Prupe.2G312500_v2.0.a1 Prupe.2G312700_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092800_v2.0.a1 Prupe.4G092800_v2.0.a1 Prupe.6G142800_v2.0.a1 Prupe.6G142800_v2.0.a1 Prupe.6G143000_v2.0.a1 Prupe.6G143100_v2.0.a1 Prupe.6G143100_v2.0.a1 Prupe.6G143100_v2.0.a1 Prupe.6G143100_v2.0.a1
pyrus_communis pycom01g23050 pycom01g23070 pycom01g23090 pycom01g23100 pycom01g23110 pycom01g23120 pycom01g23170 pycom07g26410 pycom07g26440 pycom07g26470 pycom07g26480 pycom07g26490 pycom07g26500 pycom07g26510 pycom07g26530 pycom07g26540 pycom07g26570 pycom07g26580 pycom07g26590 pycom08g20940
rosa_chinensis RchiOBHm_Chr1g0324571 RchiOBHm_Chr1g0336181 RchiOBHm_Chr1g0381061 RchiOBHm_Chr1g0381091 RchiOBHm_Chr1g0381121 RchiOBHm_Chr1g0381131 RchiOBHm_Chr1g0381141 RchiOBHm_Chr1g0381161 RchiOBHm_Chr1g0381211 RchiOBHm_Chr2g0110361 RchiOBHm_Chr2g0120231 RchiOBHm_Chr3g0486281 RchiOBHm_Chr3g0486311 RchiOBHm_Chr3g0486401 RchiOBHm_Chr4g0409511 RchiOBHm_Chr4g0409521 RchiOBHm_Chr5g0017271 RchiOBHm_Chr5g0048781 RchiOBHm_Chr5g0048811
rosa_laevigata RLG00000002401 RLG00000008559 RLG00000017798 RLG00000017799 RLG00000023082 RLG00000023088 RLG00000026230 RLG00000026238 RLG00000026240 RLG00000026241 RLG00000026242 RLG00000026243 RLG00000026244 RLG00000026246 RLG00000026247 RLG00000026248 RLG00000029876 RLG00000030189 RLG00000034579
rosa_multiflora Rmu_co8101374.1_g000001 Rmu_co8309149.1_g000001 Rmu_co8450063.1_g000001 Rmu_sc0000441.1_g000094 Rmu_sc0000479.1_g000005 Rmu_sc0000647.1_g000006 Rmu_sc0001393.1_g000031 Rmu_sc0001423.1_g000037 Rmu_sc0001616.1_g000015 Rmu_sc0001857.1_g000011 Rmu_sc0002183.1_g000013 Rmu_sc0002183.1_g000028 Rmu_sc0002183.1_g000030 Rmu_sc0002688.1_g000003 Rmu_sc0002688.1_g000020 Rmu_sc0003801.1_g000003 Rmu_sc0003801.1_g000004 Rmu_sc0004125.1_g000006 Rmu_sc0004494.1_g000005 Rmu_sc0004494.1_g000006 Rmu_sc0004494.1_g000008 Rmu_sc0004494.1_g000009 Rmu_sc0005842.1_g000004 Rmu_sc0006872.1_g000001 Rmu_sc0006872.1_g000005 Rmu_sc0006872.1_g000009 Rmu_sc0006872.1_g000010 Rmu_sc0008053.1_g000026
rosa_roxburghii Rroxscaffold_159G00432960 Rroxscaffold_1G00033060 Rroxscaffold_2G00123150 Rroxscaffold_2G00123170 Rroxscaffold_2G00133500 Rroxscaffold_2G00133550 Rroxscaffold_4G00278650 Rroxscaffold_4G00278750 Rroxscaffold_4G00278790 Rroxscaffold_4G00278800 Rroxscaffold_4G00278810 Rroxscaffold_4G00325390 Rroxscaffold_5G00354010 Rroxscaffold_6G00395890 Rroxscaffold_6G00395900 Rroxscaffold_6G00395920
rosa_rugosa Rorug01G0046900.1 Rorug01G0427000 Rorug01G0427100 Rorug01G0427200 Rorug01G0427300 Rorug01G0427400 Rorug01G0427500 Rorug01G0427500 Rorug01G0427600 Rorug01G0427600 Rorug01G0427700 Rorug01G0427700 Rorug01G0427800 Rorug01G0428700 Rorug02G0166400 Rorug02G0166500 Rorug02G0166500 Rorug02G0166600 Rorug02G0166600 Rorug02G0166700 Rorug02G0167300 Rorug02G0167300 Rorug02G0167300 Rorug03G0224600 Rorug03G0224600 Rorug04G0094400 Rorug05G0241100 Rorug05G0241200
rosa_samantha Rh1BG407700 Rh1BG407900 Rh1BG409000 Rh1CG064700 Rh1CG420900 Rh1CG421000 Rh1CG421200 Rh1CG421300 Rh1CG421800 Rh1CG421900 Rh1CG422000 Rh1CG422200 Rh1CG422300 Rh1CG423600 Rh1DG437600 Rh1DG438900 Rh1DG439000 Rh1DG440300 Rh2AG219100 Rh2CG220700 Rh2DG225300 Rh3AG274400 Rh3AG274600 Rh3CG308900 Rh3DG305800 Rh4AG156400 Rh5AG129000 Rh5AG320900 Rh5CG139600
rosa_wichuraiana Rw1G005300 Rw1G039280 Rw1G039300 Rw1G039310 Rw1G039320 Rw1G039330 Rw1G039340 Rw1G039360 Rw1G039390 Rw2G016910 Rw2G022800 Rw3G024330 Rw3G024340 Rw3G024350 Rw3G024400 Rw4G012810 Rw5G030120 Rw5G030280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 181
AccB7I CCANNNNNTGG 1 cut(s) 271
AccII CGCG 2 cut(s) 10, 182
AclWI GGATC 1 cut(s) 128
AcuI CTGAAG 1 cut(s) 342
AfaI GTAC 2 cut(s) 101, 358
AfiI CCNNNNNNNGG 2 cut(s) 271, 361
AflII CTTAAG 1 cut(s) 41
AflIII ACRYGT 1 cut(s) 180
AhdI GACNNNNNGTC 1 cut(s) 377
AjnI CCWGG 1 cut(s) 264
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
Alw21I GWGCWC 1 cut(s) 258
Alw26I GTCTC 1 cut(s) 289
AlwI GGATC 1 cut(s) 128
AoxI GGCC 1 cut(s) 201
ApaI GGGCCC 1 cut(s) 205
AspLEI GCGC 2 cut(s) 10, 12
AspS9I GGNCC 4 cut(s) 174, 201, 202, 379
AsuC2I CCSGG 1 cut(s) 388
AsuII TTCGAA 1 cut(s) 124
AvaII GGWCC 2 cut(s) 174, 379
BaeGI GKGCMC 1 cut(s) 205
BanII GRGCYC 1 cut(s) 205
BauI CACGAG 1 cut(s) 374
Bbv12I GWGCWC 1 cut(s) 258
BciT130I CCWGG 1 cut(s) 266
BcnI CCSGG 1 cut(s) 388
BcoDI GTCTC 1 cut(s) 289
BfaI CTAG 1 cut(s) 92
BfmI CTRYAG 1 cut(s) 279
BfrI CTTAAG 1 cut(s) 41
Bme1390I CCNGG 2 cut(s) 266, 388
Bme18I GGWCC 2 cut(s) 174, 379
BmeRI GACNNNNNGTC 1 cut(s) 377
BmgT120I GGNCC 4 cut(s) 174, 201, 202, 379
BmiI GGNNCC 1 cut(s) 203
BmrFI CCNGG 2 cut(s) 266, 388
BmsI GCATC 1 cut(s) 281
BplI GAGNNNNNCTC 2 cut(s) 123, 155
BpmI CTGGAG 1 cut(s) 271
Bpu14I TTCGAA 1 cut(s) 124
BpuMI CCSGG 1 cut(s) 388
BsaJI CCNNGG 3 cut(s) 264, 360, 386
Bsc4I CCNNNNNNNGG 2 cut(s) 271, 361
BseBI CCWGG 1 cut(s) 266
BseDI CCNNGG 3 cut(s) 264, 360, 386
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 2 cut(s) 271, 361
BsePI GCGCGC 1 cut(s) 8
BseSI GKGCMC 1 cut(s) 205
Bsh1236I CGCG 2 cut(s) 10, 182
BshFI GGCC 1 cut(s) 203
BsiHKAI GWGCWC 1 cut(s) 258
BsiSI CCGG 1 cut(s) 388
BslFI GGGAC 3 cut(s) 178, 247, 369
BslI CCNNNNNNNGG 2 cut(s) 271, 361
BsmAI GTCTC 1 cut(s) 289
BsmFI GGGAC 3 cut(s) 178, 247, 369
BsnI GGCC 1 cut(s) 203
Bsp119I TTCGAA 1 cut(s) 124
Bsp120I GGGCCC 1 cut(s) 201
Bsp1286I GDGCHC 2 cut(s) 205, 258
Bsp143I GATC 2 cut(s) 133, 209
BspANI GGCC 1 cut(s) 203
BspFNI CGCG 2 cut(s) 10, 182
BspLI GGNNCC 1 cut(s) 203
BspPI GGATC 1 cut(s) 128
BspT104I TTCGAA 1 cut(s) 124
BspTI CTTAAG 1 cut(s) 41
BssECI CCNNGG 3 cut(s) 264, 360, 386
BssHII GCGCGC 1 cut(s) 8
BssMI GATC 2 cut(s) 133, 209
BssSI CACGAG 1 cut(s) 374
BssT1I CCWWGG 1 cut(s) 360
Bst2BI CACGAG 1 cut(s) 374
Bst2UI CCWGG 1 cut(s) 266
Bst4CI ACNGT 3 cut(s) 83, 104, 280
Bst6I CTCTTC 1 cut(s) 318
BstAFI CTTAAG 1 cut(s) 41
BstBI TTCGAA 1 cut(s) 124
BstC8I GCNNGC 1 cut(s) 10
BstDEI CTNAG 1 cut(s) 213
BstF5I GGATG 1 cut(s) 58
BstFNI CGCG 2 cut(s) 10, 182
BstHHI GCGC 2 cut(s) 10, 12
BstKTI GATC 2 cut(s) 136, 212
BstMAI GTCTC 1 cut(s) 289
BstMBI GATC 2 cut(s) 133, 209
BstNI CCWGG 1 cut(s) 266
BstNSI RCATGY 1 cut(s) 151
BstSCI CCNGG 2 cut(s) 264, 386
BstSFI CTRYAG 1 cut(s) 279
BstSLI GKGCMC 1 cut(s) 205
BstUI CGCG 2 cut(s) 10, 182
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
BsuRI GGCC 1 cut(s) 203
BtsCI GGATG 1 cut(s) 58
BtsIMutI CAGTG 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 10
CfoI GCGC 2 cut(s) 10, 12
Cfr13I GGNCC 4 cut(s) 174, 201, 202, 379
CseI GACGC 1 cut(s) 171
Csp6I GTAC 2 cut(s) 100, 357
CviAII CATG 2 cut(s) 148, 259
CviJI RGCY 3 cut(s) 91, 203, 391
CviKI_1 RGCY 3 cut(s) 91, 203, 391
CviQI GTAC 2 cut(s) 100, 357
DdeI CTNAG 1 cut(s) 213
DpnI GATC 2 cut(s) 135, 211
DpnII GATC 2 cut(s) 133, 209
DrdI GACNNNNNNGTC 1 cut(s) 181
DriI GACNNNNNGTC 1 cut(s) 377
DseDI GACNNNNNNGTC 1 cut(s) 181
Eam1104I CTCTTC 1 cut(s) 318
Eam1105I GACNNNNNGTC 1 cut(s) 377
EarI CTCTTC 1 cut(s) 318
Eco130I CCWWGG 1 cut(s) 360
Eco24I GRGCYC 1 cut(s) 205
Eco47I GGWCC 2 cut(s) 174, 379
Eco57I CTGAAG 1 cut(s) 342
EcoRII CCWGG 1 cut(s) 264
EcoT14I CCWWGG 1 cut(s) 360
EcoT38I GRGCYC 1 cut(s) 205
ErhI CCWWGG 1 cut(s) 360
FaeI CATG 2 cut(s) 151, 262
FaiI YATR 7 cut(s) 28, 30, 38, 76, 149, 260, 301
FaqI GGGAC 3 cut(s) 178, 247, 369
FatI CATG 2 cut(s) 147, 258
FokI GGATG 1 cut(s) 65
FriOI GRGCYC 1 cut(s) 205
FspBI CTAG 1 cut(s) 92
GlaI GCGC 2 cut(s) 9, 11
GsuI CTGGAG 1 cut(s) 271
HaeIII GGCC 1 cut(s) 203
HapII CCGG 1 cut(s) 388
HgaI GACGC 1 cut(s) 171
HhaI GCGC 2 cut(s) 10, 12
Hin1II CATG 2 cut(s) 151, 262
Hin6I GCGC 2 cut(s) 8, 10
HinP1I GCGC 2 cut(s) 8, 10
HincII GTYRAC 1 cut(s) 66
HindII GTYRAC 1 cut(s) 66
HinfI GANTC 1 cut(s) 217
HpaII CCGG 1 cut(s) 388
Hpy166II GTNNAC 2 cut(s) 66, 174
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 2 cut(s) 288, 320
Hpy8I GTNNAC 2 cut(s) 66, 174
Hpy99I CGWCG 1 cut(s) 351
HpyCH4III ACNGT 3 cut(s) 83, 104, 280
HpyCH4IV ACGT 2 cut(s) 68, 98
HpyCH4V TGCA 2 cut(s) 147, 294
HpyF3I CTNAG 1 cut(s) 213
HpySE526I ACGT 2 cut(s) 68, 98
Hsp92II CATG 2 cut(s) 151, 262
HspAI GCGC 2 cut(s) 8, 10
Kzo9I GATC 2 cut(s) 133, 209
LpnPI CCDG 5 cut(s) 251, 278, 301, 333, 377
LweI GCATC 1 cut(s) 281
MaeI CTAG 1 cut(s) 92
MaeII ACGT 2 cut(s) 68, 98
MaeIII GTNAC 3 cut(s) 94, 191, 311
MalI GATC 2 cut(s) 135, 211
MboI GATC 2 cut(s) 133, 209
MboII GAAGA 1 cut(s) 335
MflI RGATCY 1 cut(s) 133
MhlI GDGCHC 2 cut(s) 205, 258
MluI ACGCGT 1 cut(s) 180
MmeI TCCRAC 1 cut(s) 245
MnlI CCTC 2 cut(s) 319, 370
MseI TTAA 1 cut(s) 42
MspCI CTTAAG 1 cut(s) 41
MspI CCGG 1 cut(s) 388
MspR9I CCNGG 2 cut(s) 266, 388
MvaI CCWGG 1 cut(s) 266
MvnI CGCG 2 cut(s) 10, 182
NciI CCSGG 1 cut(s) 388
NdeII GATC 2 cut(s) 133, 209
NlaIII CATG 2 cut(s) 151, 262
NlaIV GGNNCC 1 cut(s) 203
NmuCI GTSAC 2 cut(s) 94, 191
NspI RCATGY 1 cut(s) 151
NspV TTCGAA 1 cut(s) 124
PauI GCGCGC 1 cut(s) 8
PcsI WCGNNNNNNNCGW 1 cut(s) 352
PfeI GAWTC 1 cut(s) 217
PflMI CCANNNNNTGG 1 cut(s) 271
Psp6I CCWGG 1 cut(s) 264
PspGI CCWGG 1 cut(s) 264
PspN4I GGNNCC 1 cut(s) 203
PspOMI GGGCCC 1 cut(s) 201
PspPI GGNCC 4 cut(s) 174, 201, 202, 379
PsuI RGATCY 1 cut(s) 133
PteI GCGCGC 1 cut(s) 8
RsaI GTAC 2 cut(s) 101, 358
RsaNI GTAC 2 cut(s) 100, 357
SaqAI TTAA 1 cut(s) 42
Sau3AI GATC 2 cut(s) 133, 209
Sau96I GGNCC 4 cut(s) 174, 201, 202, 379
ScrFI CCNGG 2 cut(s) 266, 388
SduI GDGCHC 2 cut(s) 205, 258
SetI ASST 7 cut(s) 71, 93, 101, 116, 179, 330, 381
SfaNI GCATC 1 cut(s) 281
SfcI CTRYAG 1 cut(s) 279
SfuI TTCGAA 1 cut(s) 124
SinI GGWCC 2 cut(s) 174, 379
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
SspMI CTAG 1 cut(s) 92
StyD4I CCNGG 2 cut(s) 264, 386
StyI CCWWGG 1 cut(s) 360
TaaI ACNGT 3 cut(s) 83, 104, 280
TaiI ACGT 2 cut(s) 71, 101
TaqI TCGA 4 cut(s) 124, 141, 188, 232
TfiI GAWTC 1 cut(s) 217
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 2 cut(s) 94, 191
Tsp45I GTSAC 2 cut(s) 94, 191
TspDTI ATGAA 2 cut(s) 69, 142
TspGWI ACGGA 2 cut(s) 344, 371
TspRI CASTG 1 cut(s) 109
Van91I CCANNNNNTGG 1 cut(s) 271
Vha464I CTTAAG 1 cut(s) 41
VpaK11BI GGWCC 2 cut(s) 174, 379
XceI RCATGY 1 cut(s) 151
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.