Rmu_sc0000647.1_g000006

Cyclic nucleotide-gated ion channel 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000647.1
OG0000119
Physical Location & Seq
Forward (+)
18930 .. 19568
639 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000647.1_g000006.1.cds

Sequence Viewer

Length: 639 bp
atgccaggatcggagaaaccaggccaagagagtaaagataaccaaaaaaaaatgttgacaaaaatttgtgactttctgaagccggtggtctacccggatggtagatatgtttaccgaataggagaaccacttgatcgcatgctcttaattagagacggtttaatatggacatataacaccaccagtaccagtagtgctagtgcaagtcaagatgaaggccatggaacaggttcaacttgccttgggaaaggtgaattttacggcgatgaacttctgagttgggcatctgatagtcttaaatctttggacaaccttcctgtgttgaaagcaaatgcaaaagctcatggaaaagtagaaggatttgttcttatggccaaggacttgaaagttgtagtcgacaaatacaaaatgtattggggtttccctaattctcttgtaaaagaggaggcagcacttgagaccgtaaaaaaattccgtcagcaagcaaaattgaagcgtgagaaagatcaacaaaaggtccagcaaccggagcatccaaaagttgatgttctaccaacatcagcagtcatggcccctccaccggaggctgcagtagtacttgacgttcgagcagaaaacacaacaacagctagcagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
Ion_trans

Protein Analysis

212

Amino Acids

23.46

Weight (kDa)

8.36

Isoelectric Point (pI)

27.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000119)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g10570 FvH4_4g36390 FvH4_7g31840 FvH4_7g31840 FvH4_7g31850 FvH4_7g31850 FvH4_7g31861 FvH4_7g31861 FvH4_7g31950
malus_domestica MD01G1054600.v1.1 MD01G1221100.v1.1 MD01G1221400.v1.1 MD01G1221600.v1.1 MD01G1221800.v1.1 MD01G1222000.v1.1 MD01G1222100.v1.1 MD07G1140800.v1.1 MD07G1291200.v1.1 MD07G1291400.v1.1 MD07G1291500.v1.1 MD07G1291700.v1.1 MD07G1292500.v1.1 MD07G1292700.v1.1 MD07G1292800.v1.1 MD07G1292900.v1.1 MD08G1241600.v1.1 MD11G1083800.v1.1 MD15G1431600.v1.1
prunus_persica Prupe.1G017800_v2.0.a1 Prupe.1G017800_v2.0.a1 Prupe.1G162800_v2.0.a1 Prupe.2G312500_v2.0.a1 Prupe.2G312500_v2.0.a1 Prupe.2G312700_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092800_v2.0.a1 Prupe.4G092800_v2.0.a1 Prupe.6G142800_v2.0.a1 Prupe.6G142800_v2.0.a1 Prupe.6G143000_v2.0.a1 Prupe.6G143100_v2.0.a1 Prupe.6G143100_v2.0.a1 Prupe.6G143100_v2.0.a1 Prupe.6G143100_v2.0.a1
pyrus_communis pycom01g23050 pycom01g23070 pycom01g23090 pycom01g23100 pycom01g23110 pycom01g23120 pycom01g23170 pycom07g26410 pycom07g26440 pycom07g26470 pycom07g26480 pycom07g26490 pycom07g26500 pycom07g26510 pycom07g26530 pycom07g26540 pycom07g26570 pycom07g26580 pycom07g26590 pycom08g20940
rosa_chinensis RchiOBHm_Chr1g0324571 RchiOBHm_Chr1g0336181 RchiOBHm_Chr1g0381061 RchiOBHm_Chr1g0381091 RchiOBHm_Chr1g0381121 RchiOBHm_Chr1g0381131 RchiOBHm_Chr1g0381141 RchiOBHm_Chr1g0381161 RchiOBHm_Chr1g0381211 RchiOBHm_Chr2g0110361 RchiOBHm_Chr2g0120231 RchiOBHm_Chr3g0486281 RchiOBHm_Chr3g0486311 RchiOBHm_Chr3g0486401 RchiOBHm_Chr4g0409511 RchiOBHm_Chr4g0409521 RchiOBHm_Chr5g0017271 RchiOBHm_Chr5g0048781 RchiOBHm_Chr5g0048811
rosa_laevigata RLG00000002401 RLG00000008559 RLG00000017798 RLG00000017799 RLG00000023082 RLG00000023088 RLG00000026230 RLG00000026238 RLG00000026240 RLG00000026241 RLG00000026242 RLG00000026243 RLG00000026244 RLG00000026246 RLG00000026247 RLG00000026248 RLG00000029876 RLG00000030189 RLG00000034579
rosa_multiflora Rmu_co8101374.1_g000001 Rmu_co8309149.1_g000001 Rmu_co8450063.1_g000001 Rmu_sc0000441.1_g000094 Rmu_sc0000479.1_g000005 Rmu_sc0000647.1_g000006 Rmu_sc0001393.1_g000031 Rmu_sc0001423.1_g000037 Rmu_sc0001616.1_g000015 Rmu_sc0001857.1_g000011 Rmu_sc0002183.1_g000013 Rmu_sc0002183.1_g000028 Rmu_sc0002183.1_g000030 Rmu_sc0002688.1_g000003 Rmu_sc0002688.1_g000020 Rmu_sc0003801.1_g000003 Rmu_sc0003801.1_g000004 Rmu_sc0004125.1_g000006 Rmu_sc0004494.1_g000005 Rmu_sc0004494.1_g000006 Rmu_sc0004494.1_g000008 Rmu_sc0004494.1_g000009 Rmu_sc0005842.1_g000004 Rmu_sc0006872.1_g000001 Rmu_sc0006872.1_g000005 Rmu_sc0006872.1_g000009 Rmu_sc0006872.1_g000010 Rmu_sc0008053.1_g000026
rosa_roxburghii Rroxscaffold_159G00432960 Rroxscaffold_1G00033060 Rroxscaffold_2G00123150 Rroxscaffold_2G00123170 Rroxscaffold_2G00133500 Rroxscaffold_2G00133550 Rroxscaffold_4G00278650 Rroxscaffold_4G00278750 Rroxscaffold_4G00278790 Rroxscaffold_4G00278800 Rroxscaffold_4G00278810 Rroxscaffold_4G00325390 Rroxscaffold_5G00354010 Rroxscaffold_6G00395890 Rroxscaffold_6G00395900 Rroxscaffold_6G00395920
rosa_rugosa Rorug01G0046900.1 Rorug01G0427000 Rorug01G0427100 Rorug01G0427200 Rorug01G0427300 Rorug01G0427400 Rorug01G0427500 Rorug01G0427500 Rorug01G0427600 Rorug01G0427600 Rorug01G0427700 Rorug01G0427700 Rorug01G0427800 Rorug01G0428700 Rorug02G0166400 Rorug02G0166500 Rorug02G0166500 Rorug02G0166600 Rorug02G0166600 Rorug02G0166700 Rorug02G0167300 Rorug02G0167300 Rorug02G0167300 Rorug03G0224600 Rorug03G0224600 Rorug04G0094400 Rorug05G0241100 Rorug05G0241200
rosa_samantha Rh1BG407700 Rh1BG407900 Rh1BG409000 Rh1CG064700 Rh1CG420900 Rh1CG421000 Rh1CG421200 Rh1CG421300 Rh1CG421800 Rh1CG421900 Rh1CG422000 Rh1CG422200 Rh1CG422300 Rh1CG423600 Rh1DG437600 Rh1DG438900 Rh1DG439000 Rh1DG440300 Rh2AG219100 Rh2CG220700 Rh2DG225300 Rh3AG274400 Rh3AG274600 Rh3CG308900 Rh3DG305800 Rh4AG156400 Rh5AG129000 Rh5AG320900 Rh5CG139600
rosa_wichuraiana Rw1G005300 Rw1G039280 Rw1G039300 Rw1G039310 Rw1G039320 Rw1G039330 Rw1G039340 Rw1G039360 Rw1G039390 Rw2G016910 Rw2G022800 Rw3G024330 Rw3G024340 Rw3G024350 Rw3G024400 Rw4G012810 Rw5G030120 Rw5G030280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 90, 396
AclWI GGATC 1 cut(s) 16
AcoI YGGCCR 1 cut(s) 372
AcsI RAATTY 3 cut(s) 63, 254, 470
AcuI CTGAAG 1 cut(s) 98
AfaI GTAC 2 cut(s) 187, 597
AfiI CCNNNNNNNGG 2 cut(s) 526, 580
AgsI TTSAA 4 cut(s) 234, 325, 385, 493
AjnI CCWGG 2 cut(s) 4, 19
AluBI AGCT 2 cut(s) 341, 629
AluI AGCT 2 cut(s) 341, 629
Alw26I GTCTC 2 cut(s) 147, 452
AlwI GGATC 1 cut(s) 16
AoxI GGCC 4 cut(s) 22, 217, 372, 570
ApeKI GCWGC 2 cut(s) 449, 587
ApoI RAATTY 3 cut(s) 63, 254, 470
Asp700I GAANNNNTTC 1 cut(s) 229
AspS9I GGNCC 2 cut(s) 517, 571
AsuC2I CCSGG 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 263
AsuNHI GCTAGC 1 cut(s) 629
AvaII GGWCC 1 cut(s) 517
BalI TGGCCA 1 cut(s) 374
BbvI GCAGC 2 cut(s) 461, 574
BccI CCATC 1 cut(s) 92
BceAI ACGGC 1 cut(s) 277
BciT130I CCWGG 2 cut(s) 6, 21
BcnI CCSGG 1 cut(s) 95
BcoDI GTCTC 2 cut(s) 147, 452
BfaI CTAG 2 cut(s) 198, 630
BfmI CTRYAG 1 cut(s) 588
BisI GCNGC 2 cut(s) 450, 588
BlsI GCNGC 2 cut(s) 451, 589
BmcAI AGTACT 1 cut(s) 597
Bme1390I CCNGG 3 cut(s) 6, 21, 95
Bme18I GGWCC 1 cut(s) 517
BmgT120I GGNCC 2 cut(s) 517, 571
BmiI GGNNCC 1 cut(s) 573
BmrFI CCNGG 3 cut(s) 6, 21, 95
BmsI GCATC 2 cut(s) 293, 541
BmtI GCTAGC 1 cut(s) 633
BpuEI CTTGAG 1 cut(s) 476
BpuMI CCSGG 1 cut(s) 95
BsaI GGTCTC 1 cut(s) 452
BsaJI CCNNGG 3 cut(s) 220, 241, 375
BsaWI WCCGGW 2 cut(s) 526, 580
Bsc4I CCNNNNNNNGG 2 cut(s) 526, 580
Bse118I RCCGGY 1 cut(s) 82
Bse1I ACTGG 2 cut(s) 183, 189
BseBI CCWGG 2 cut(s) 6, 21
BseDI CCNNGG 3 cut(s) 220, 241, 375
BseGI GGATG 2 cut(s) 103, 532
BseLI CCNNNNNNNGG 2 cut(s) 526, 580
BseMII CTCAG 1 cut(s) 266
BseNI ACTGG 2 cut(s) 183, 189
BseRI GAGGAG 1 cut(s) 458
BseXI GCAGC 2 cut(s) 461, 574
BshFI GGCC 4 cut(s) 24, 219, 374, 572
BsiSI CCGG 4 cut(s) 83, 95, 527, 581
BslI CCNNNNNNNGG 2 cut(s) 526, 580
BsmAI GTCTC 2 cut(s) 147, 452
BsmBI CGTCTC 1 cut(s) 147
BsnI GGCC 4 cut(s) 24, 219, 374, 572
Bso31I GGTCTC 1 cut(s) 452
Bsp143I GATC 3 cut(s) 8, 133, 505
Bsp19I CCATGG 1 cut(s) 220
BspANI GGCC 4 cut(s) 24, 219, 374, 572
BspCNI CTCAG 1 cut(s) 267
BspLI GGNNCC 1 cut(s) 573
BspMAI CTGCAG 1 cut(s) 592
BspOI GCTAGC 1 cut(s) 633
BspPI GGATC 1 cut(s) 16
BspTNI GGTCTC 1 cut(s) 452
BsrFI RCCGGY 1 cut(s) 82
BsrI ACTGG 2 cut(s) 183, 189
BssAI RCCGGY 1 cut(s) 82
BssECI CCNNGG 3 cut(s) 220, 241, 375
BssMI GATC 3 cut(s) 8, 133, 505
BssT1I CCWWGG 3 cut(s) 220, 241, 375
Bst2UI CCWGG 2 cut(s) 6, 21
Bst4CI ACNGT 2 cut(s) 158, 463
BstC8I GCNNGC 3 cut(s) 140, 483, 631
BstDEI CTNAG 1 cut(s) 275
BstDSI CCRYGG 1 cut(s) 220
BstF5I GGATG 2 cut(s) 103, 532
BstKTI GATC 3 cut(s) 11, 136, 508
BstMAI GTCTC 2 cut(s) 147, 452
BstMBI GATC 3 cut(s) 8, 133, 505
BstMWI GCNNNNNNNGC 2 cut(s) 529, 569
BstNI CCWGG 2 cut(s) 6, 21
BstNSI RCATGY 1 cut(s) 142
BstSCI CCNGG 3 cut(s) 4, 19, 93
BstSFI CTRYAG 1 cut(s) 588
BstV1I GCAGC 2 cut(s) 461, 574
BsuRI GGCC 4 cut(s) 24, 219, 374, 572
BtgI CCRYGG 1 cut(s) 220
BtgZI GCGATG 1 cut(s) 279
BtsCI GGATG 2 cut(s) 103, 532
Cac8I GCNNGC 3 cut(s) 140, 483, 631
Cfr10I RCCGGY 1 cut(s) 82
Cfr13I GGNCC 2 cut(s) 517, 571
Csp6I GTAC 2 cut(s) 186, 596
CviAII CATG 4 cut(s) 139, 221, 344, 568
CviJI RGCY 8 cut(s) 24, 82, 219, 341, 374, 572, 587, 629
CviKI_1 RGCY 8 cut(s) 24, 82, 219, 341, 374, 572, 587, 629
CviQI GTAC 2 cut(s) 186, 596
DdeI CTNAG 1 cut(s) 275
DpnI GATC 3 cut(s) 10, 135, 507
DpnII GATC 3 cut(s) 8, 133, 505
EaeI YGGCCR 1 cut(s) 372
Eco130I CCWWGG 3 cut(s) 220, 241, 375
Eco31I GGTCTC 1 cut(s) 452
Eco47I GGWCC 1 cut(s) 517
Eco57I CTGAAG 1 cut(s) 98
EcoRII CCWGG 2 cut(s) 4, 19
EcoT14I CCWWGG 3 cut(s) 220, 241, 375
ErhI CCWWGG 3 cut(s) 220, 241, 375
Esp3I CGTCTC 1 cut(s) 147
FaeI CATG 4 cut(s) 142, 224, 347, 571
FaiI YATR 9 cut(s) 108, 140, 166, 172, 174, 222, 345, 371, 569
FatI CATG 4 cut(s) 138, 220, 343, 567
FblI GTMKAC 2 cut(s) 90, 396
Fnu4HI GCNGC 2 cut(s) 450, 588
FokI GGATG 2 cut(s) 110, 519
Fsp4HI GCNGC 2 cut(s) 450, 588
FspBI CTAG 2 cut(s) 198, 630
GluI GCNGC 2 cut(s) 450, 588
HaeIII GGCC 4 cut(s) 24, 219, 374, 572
HapII CCGG 4 cut(s) 83, 95, 527, 581
Hin1II CATG 4 cut(s) 142, 224, 347, 571
HincII GTYRAC 2 cut(s) 57, 397
HindII GTYRAC 2 cut(s) 57, 397
HpaII CCGG 4 cut(s) 83, 95, 527, 581
HphI GGTGA 1 cut(s) 263
Hpy166II GTNNAC 4 cut(s) 57, 91, 112, 397
Hpy188I TCNGA 4 cut(s) 13, 78, 276, 289
Hpy188III TCNNGA 1 cut(s) 209
Hpy8I GTNNAC 4 cut(s) 57, 91, 112, 397
HpyAV CCTTC 3 cut(s) 209, 323, 350
HpyCH4III ACNGT 2 cut(s) 158, 463
HpyCH4IV ACGT 1 cut(s) 603
HpyCH4V TGCA 3 cut(s) 203, 335, 590
HpyF10VI GCNNNNNNNGC 2 cut(s) 529, 569
HpyF3I CTNAG 1 cut(s) 275
HpySE526I ACGT 1 cut(s) 603
Hsp92II CATG 4 cut(s) 142, 224, 347, 571
Kzo9I GATC 3 cut(s) 8, 133, 505
LmnI GCTCC 1 cut(s) 529
Lsp1109I GCAGC 2 cut(s) 461, 574
LweI GCATC 2 cut(s) 293, 541
MaeI CTAG 2 cut(s) 198, 630
MaeII ACGT 1 cut(s) 603
MaeIII GTNAC 1 cut(s) 68
MalI GATC 3 cut(s) 10, 135, 507
MboI GATC 3 cut(s) 8, 133, 505
MlsI TGGCCA 1 cut(s) 374
MluCI AATT 6 cut(s) 63, 147, 254, 427, 470, 488
MluNI TGGCCA 1 cut(s) 374
MnlI CCTC 4 cut(s) 436, 439, 577, 585
Mox20I TGGCCA 1 cut(s) 374
MroXI GAANNNNTTC 1 cut(s) 229
MscI TGGCCA 1 cut(s) 374
MseI TTAA 4 cut(s) 146, 161, 297, 637
Msp20I TGGCCA 1 cut(s) 374
MspI CCGG 4 cut(s) 83, 95, 527, 581
MspR9I CCNGG 3 cut(s) 6, 21, 95
MvaI CCWGG 2 cut(s) 6, 21
MwoI GCNNNNNNNGC 2 cut(s) 529, 569
NciI CCSGG 1 cut(s) 95
NcoI CCATGG 1 cut(s) 220
NdeII GATC 3 cut(s) 8, 133, 505
NheI GCTAGC 1 cut(s) 629
NlaIII CATG 4 cut(s) 142, 224, 347, 571
NlaIV GGNNCC 1 cut(s) 573
NmuCI GTSAC 1 cut(s) 68
NspI RCATGY 1 cut(s) 142
PaeI GCATGC 1 cut(s) 142
PdmI GAANNNNTTC 1 cut(s) 229
PkrI GCNGC 2 cut(s) 451, 589
Psp6I CCWGG 2 cut(s) 4, 19
PspGI CCWGG 2 cut(s) 4, 19
PspN4I GGNNCC 1 cut(s) 573
PspPI GGNCC 2 cut(s) 517, 571
PsrI GAACNNNNNNTAC 2 cut(s) 588, 620
PstI CTGCAG 1 cut(s) 592
RsaI GTAC 2 cut(s) 187, 597
RsaNI GTAC 2 cut(s) 186, 596
SalI GTCGAC 1 cut(s) 395
SaqAI TTAA 4 cut(s) 146, 161, 297, 637
SatI GCNGC 2 cut(s) 450, 588
Sau3AI GATC 3 cut(s) 8, 133, 505
Sau96I GGNCC 2 cut(s) 517, 571
ScaI AGTACT 1 cut(s) 597
ScrFI CCNGG 3 cut(s) 6, 21, 95
SetI ASST 7 cut(s) 232, 253, 315, 343, 519, 606, 631
SfaNI GCATC 2 cut(s) 293, 541
SfcI CTRYAG 1 cut(s) 588
SinI GGWCC 1 cut(s) 517
SmlI CTYRAG 1 cut(s) 455
SmoI CTYRAG 1 cut(s) 455
SphI GCATGC 1 cut(s) 142
Sse9I AATT 6 cut(s) 63, 147, 254, 427, 470, 488
SspMI CTAG 2 cut(s) 198, 630
StyD4I CCNGG 3 cut(s) 4, 19, 93
StyI CCWWGG 3 cut(s) 220, 241, 375
TaaI ACNGT 2 cut(s) 158, 463
TaiI ACGT 1 cut(s) 606
TaqI TCGA 2 cut(s) 396, 607
TasI AATT 6 cut(s) 63, 147, 254, 427, 470, 488
TatI WGTACW 1 cut(s) 595
Tru1I TTAA 4 cut(s) 146, 161, 297, 637
Tru9I TTAA 4 cut(s) 146, 161, 297, 637
TseFI GTSAC 1 cut(s) 68
TseI GCWGC 2 cut(s) 449, 587
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 2 cut(s) 228, 282
TspGWI ACGGA 1 cut(s) 464
VpaK11BI GGWCC 1 cut(s) 517
XapI RAATTY 3 cut(s) 63, 254, 470
XceI RCATGY 1 cut(s) 142
XmiI GTMKAC 2 cut(s) 90, 396
XmnI GAANNNNTTC 1 cut(s) 229
XspI CTAG 2 cut(s) 198, 630
ZrmI AGTACT 1 cut(s) 597
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.