Rmu_co8101374.1_g000001

Cyclic nucleotide-gated ion channel 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8101374.1
OG0000119
Physical Location & Seq
Forward (+)
52 .. 366
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8101374.1_g000001.1.cds

Sequence Viewer

Length: 315 bp
atggacaccaacttcctcaagaagggtgattcttatggacacgctcttctgcagtttgcatcatcatctcttgtggcactccctacctcagctgcaaatgtccggtgtcacacaaaggtagaggcgttcgttctcatggccaaggacctgaaaaacatagtaactaaatgcgaaaatttttggcctttcgactacaatgcttctaaagatgaggcggtgaatcaggtcacacccctgggccagtttcagcaacaacaaatgccaaagaagcgtgtatcaacatcgatcatcaaccccaccggctatagtggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
Ion_trans cNMP_binding

Protein Analysis

104

Amino Acids

11.52

Weight (kDa)

8.98

Isoelectric Point (pI)

27.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000119)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g10570 FvH4_4g36390 FvH4_7g31840 FvH4_7g31840 FvH4_7g31850 FvH4_7g31850 FvH4_7g31861 FvH4_7g31861 FvH4_7g31950
malus_domestica MD01G1054600.v1.1 MD01G1221100.v1.1 MD01G1221400.v1.1 MD01G1221600.v1.1 MD01G1221800.v1.1 MD01G1222000.v1.1 MD01G1222100.v1.1 MD07G1140800.v1.1 MD07G1291200.v1.1 MD07G1291400.v1.1 MD07G1291500.v1.1 MD07G1291700.v1.1 MD07G1292500.v1.1 MD07G1292700.v1.1 MD07G1292800.v1.1 MD07G1292900.v1.1 MD08G1241600.v1.1 MD11G1083800.v1.1 MD15G1431600.v1.1
prunus_persica Prupe.1G017800_v2.0.a1 Prupe.1G017800_v2.0.a1 Prupe.1G162800_v2.0.a1 Prupe.2G312500_v2.0.a1 Prupe.2G312500_v2.0.a1 Prupe.2G312700_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092600_v2.0.a1 Prupe.4G092800_v2.0.a1 Prupe.4G092800_v2.0.a1 Prupe.6G142800_v2.0.a1 Prupe.6G142800_v2.0.a1 Prupe.6G143000_v2.0.a1 Prupe.6G143100_v2.0.a1 Prupe.6G143100_v2.0.a1 Prupe.6G143100_v2.0.a1 Prupe.6G143100_v2.0.a1
pyrus_communis pycom01g23050 pycom01g23070 pycom01g23090 pycom01g23100 pycom01g23110 pycom01g23120 pycom01g23170 pycom07g26410 pycom07g26440 pycom07g26470 pycom07g26480 pycom07g26490 pycom07g26500 pycom07g26510 pycom07g26530 pycom07g26540 pycom07g26570 pycom07g26580 pycom07g26590 pycom08g20940
rosa_chinensis RchiOBHm_Chr1g0324571 RchiOBHm_Chr1g0336181 RchiOBHm_Chr1g0381061 RchiOBHm_Chr1g0381091 RchiOBHm_Chr1g0381121 RchiOBHm_Chr1g0381131 RchiOBHm_Chr1g0381141 RchiOBHm_Chr1g0381161 RchiOBHm_Chr1g0381211 RchiOBHm_Chr2g0110361 RchiOBHm_Chr2g0120231 RchiOBHm_Chr3g0486281 RchiOBHm_Chr3g0486311 RchiOBHm_Chr3g0486401 RchiOBHm_Chr4g0409511 RchiOBHm_Chr4g0409521 RchiOBHm_Chr5g0017271 RchiOBHm_Chr5g0048781 RchiOBHm_Chr5g0048811
rosa_laevigata RLG00000002401 RLG00000008559 RLG00000017798 RLG00000017799 RLG00000023082 RLG00000023088 RLG00000026230 RLG00000026238 RLG00000026240 RLG00000026241 RLG00000026242 RLG00000026243 RLG00000026244 RLG00000026246 RLG00000026247 RLG00000026248 RLG00000029876 RLG00000030189 RLG00000034579
rosa_multiflora Rmu_co8101374.1_g000001 Rmu_co8309149.1_g000001 Rmu_co8450063.1_g000001 Rmu_sc0000441.1_g000094 Rmu_sc0000479.1_g000005 Rmu_sc0000647.1_g000006 Rmu_sc0001393.1_g000031 Rmu_sc0001423.1_g000037 Rmu_sc0001616.1_g000015 Rmu_sc0001857.1_g000011 Rmu_sc0002183.1_g000013 Rmu_sc0002183.1_g000028 Rmu_sc0002183.1_g000030 Rmu_sc0002688.1_g000003 Rmu_sc0002688.1_g000020 Rmu_sc0003801.1_g000003 Rmu_sc0003801.1_g000004 Rmu_sc0004125.1_g000006 Rmu_sc0004494.1_g000005 Rmu_sc0004494.1_g000006 Rmu_sc0004494.1_g000008 Rmu_sc0004494.1_g000009 Rmu_sc0005842.1_g000004 Rmu_sc0006872.1_g000001 Rmu_sc0006872.1_g000005 Rmu_sc0006872.1_g000009 Rmu_sc0006872.1_g000010 Rmu_sc0008053.1_g000026
rosa_roxburghii Rroxscaffold_159G00432960 Rroxscaffold_1G00033060 Rroxscaffold_2G00123150 Rroxscaffold_2G00123170 Rroxscaffold_2G00133500 Rroxscaffold_2G00133550 Rroxscaffold_4G00278650 Rroxscaffold_4G00278750 Rroxscaffold_4G00278790 Rroxscaffold_4G00278800 Rroxscaffold_4G00278810 Rroxscaffold_4G00325390 Rroxscaffold_5G00354010 Rroxscaffold_6G00395890 Rroxscaffold_6G00395900 Rroxscaffold_6G00395920
rosa_rugosa Rorug01G0046900.1 Rorug01G0427000 Rorug01G0427100 Rorug01G0427200 Rorug01G0427300 Rorug01G0427400 Rorug01G0427500 Rorug01G0427500 Rorug01G0427600 Rorug01G0427600 Rorug01G0427700 Rorug01G0427700 Rorug01G0427800 Rorug01G0428700 Rorug02G0166400 Rorug02G0166500 Rorug02G0166500 Rorug02G0166600 Rorug02G0166600 Rorug02G0166700 Rorug02G0167300 Rorug02G0167300 Rorug02G0167300 Rorug03G0224600 Rorug03G0224600 Rorug04G0094400 Rorug05G0241100 Rorug05G0241200
rosa_samantha Rh1BG407700 Rh1BG407900 Rh1BG409000 Rh1CG064700 Rh1CG420900 Rh1CG421000 Rh1CG421200 Rh1CG421300 Rh1CG421800 Rh1CG421900 Rh1CG422000 Rh1CG422200 Rh1CG422300 Rh1CG423600 Rh1DG437600 Rh1DG438900 Rh1DG439000 Rh1DG440300 Rh2AG219100 Rh2CG220700 Rh2DG225300 Rh3AG274400 Rh3AG274600 Rh3CG308900 Rh3DG305800 Rh4AG156400 Rh5AG129000 Rh5AG320900 Rh5CG139600
rosa_wichuraiana Rw1G005300 Rw1G039280 Rw1G039300 Rw1G039310 Rw1G039320 Rw1G039330 Rw1G039340 Rw1G039360 Rw1G039390 Rw2G016910 Rw2G022800 Rw3G024330 Rw3G024340 Rw3G024350 Rw3G024400 Rw4G012810 Rw5G030120 Rw5G030280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 215
AcoI YGGCCR 1 cut(s) 138
AcsI RAATTY 1 cut(s) 175
AfiI CCNNNNNNNGG 1 cut(s) 22
AjnI CCWGG 1 cut(s) 234
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
AoxI GGCC 3 cut(s) 138, 182, 238
ApeKI GCWGC 1 cut(s) 92
ApoI RAATTY 1 cut(s) 175
AspS9I GGNCC 2 cut(s) 145, 238
AsuHPI GGTGA 2 cut(s) 38, 229
AvaII GGWCC 1 cut(s) 145
BalI TGGCCA 1 cut(s) 140
BbvCI CCTCAGC 1 cut(s) 88
BbvI GCAGC 1 cut(s) 79
BcgI CGANNNNNNTGC 2 cut(s) 179, 213
BciT130I CCWGG 1 cut(s) 236
BfmI CTRYAG 2 cut(s) 50, 304
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
Bme1390I CCNGG 1 cut(s) 236
Bme18I GGWCC 1 cut(s) 145
BmgT120I GGNCC 2 cut(s) 145, 238
BmrFI CCNGG 1 cut(s) 236
BmsI GCATC 1 cut(s) 68
Bpu10I CCTNAGC 1 cut(s) 88
Bsa29I ATCGAT 1 cut(s) 284
BsaJI CCNNGG 3 cut(s) 141, 234, 235
BsaWI WCCGGW 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse118I RCCGGY 1 cut(s) 299
Bse1I ACTGG 1 cut(s) 241
BseBI CCWGG 1 cut(s) 236
BseCI ATCGAT 1 cut(s) 284
BseDI CCNNGG 3 cut(s) 141, 234, 235
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 102
BseNI ACTGG 1 cut(s) 241
BseXI GCAGC 1 cut(s) 79
BshFI GGCC 3 cut(s) 140, 184, 240
BshVI ATCGAT 1 cut(s) 284
BsiSI CCGG 2 cut(s) 103, 300
BslI CCNNNNNNNGG 1 cut(s) 22
BsnI GGCC 3 cut(s) 140, 184, 240
Bsp143I GATC 1 cut(s) 285
BspACI CCGC 1 cut(s) 215
BspANI GGCC 3 cut(s) 140, 184, 240
BspCNI CTCAG 1 cut(s) 101
BspDI ATCGAT 1 cut(s) 284
BspMAI CTGCAG 1 cut(s) 54
BspQI GCTCTTC 1 cut(s) 51
BsrFI RCCGGY 1 cut(s) 299
BsrI ACTGG 1 cut(s) 241
BssAI RCCGGY 1 cut(s) 299
BssECI CCNNGG 3 cut(s) 141, 234, 235
BssMI GATC 1 cut(s) 285
BssT1I CCWWGG 1 cut(s) 141
Bst2UI CCWGG 1 cut(s) 236
Bst6I CTCTTC 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 88
BstENI CCTNNNNNAGG 1 cut(s) 20
BstKTI GATC 1 cut(s) 288
BstMBI GATC 1 cut(s) 285
BstMWI GCNNNNNNNGC 1 cut(s) 268
BstNI CCWGG 1 cut(s) 236
BstSCI CCNGG 1 cut(s) 234
BstSFI CTRYAG 2 cut(s) 50, 304
BstV1I GCAGC 1 cut(s) 79
Bsu15I ATCGAT 1 cut(s) 284
BsuRI GGCC 3 cut(s) 140, 184, 240
BsuTUI ATCGAT 1 cut(s) 284
Cfr10I RCCGGY 1 cut(s) 299
Cfr13I GGNCC 2 cut(s) 145, 238
ClaI ATCGAT 1 cut(s) 284
CviAII CATG 1 cut(s) 136
CviJI RGCY 5 cut(s) 92, 140, 184, 240, 303
CviKI_1 RGCY 5 cut(s) 92, 140, 184, 240, 303
DdeI CTNAG 1 cut(s) 88
DpnI GATC 1 cut(s) 287
DpnII GATC 1 cut(s) 285
EaeI YGGCCR 1 cut(s) 138
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco130I CCWWGG 1 cut(s) 141
Eco47I GGWCC 1 cut(s) 145
EcoNI CCTNNNNNAGG 1 cut(s) 20
EcoO109I RGGNCCY 1 cut(s) 145
EcoRII CCWGG 1 cut(s) 234
EcoT14I CCWWGG 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 1 cut(s) 139
FaiI YATR 4 cut(s) 36, 137, 158, 306
FatI CATG 1 cut(s) 135
Fnu4HI GCNGC 1 cut(s) 93
Fsp4HI GCNGC 1 cut(s) 93
GluI GCNGC 1 cut(s) 93
HaeIII GGCC 3 cut(s) 140, 184, 240
HapII CCGG 2 cut(s) 103, 300
Hin1II CATG 1 cut(s) 139
HinfI GANTC 2 cut(s) 29, 220
HpaII CCGG 2 cut(s) 103, 300
HphI GGTGA 2 cut(s) 38, 229
Hpy188III TCNNGA 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 16
HpyCH4V TGCA 3 cut(s) 52, 59, 95
HpyF10VI GCNNNNNNNGC 1 cut(s) 268
HpyF3I CTNAG 1 cut(s) 88
Hsp92II CATG 1 cut(s) 139
Kzo9I GATC 1 cut(s) 285
LguI GCTCTTC 1 cut(s) 51
LpnPI CCDG 6 cut(s) 116, 161, 209, 221, 248, 254
Lsp1109I GCAGC 1 cut(s) 79
LweI GCATC 1 cut(s) 68
MaeIII GTNAC 3 cut(s) 107, 160, 226
MalI GATC 1 cut(s) 287
MboI GATC 1 cut(s) 285
MboII GAAGA 1 cut(s) 38
MlsI TGGCCA 1 cut(s) 140
MluCI AATT 1 cut(s) 175
MluNI TGGCCA 1 cut(s) 140
MnlI CCTC 4 cut(s) 26, 97, 115, 205
Mox20I TGGCCA 1 cut(s) 140
MscI TGGCCA 1 cut(s) 140
Msp20I TGGCCA 1 cut(s) 140
MspA1I CMGCKG 1 cut(s) 92
MspI CCGG 2 cut(s) 103, 300
MspR9I CCNGG 1 cut(s) 236
MvaI CCWGG 1 cut(s) 236
MwoI GCNNNNNNNGC 1 cut(s) 268
NdeII GATC 1 cut(s) 285
NlaIII CATG 1 cut(s) 139
NmuCI GTSAC 2 cut(s) 107, 226
PasI CCCWGGG 1 cut(s) 235
PciSI GCTCTTC 1 cut(s) 51
PfeI GAWTC 2 cut(s) 29, 220
PkrI GCNGC 1 cut(s) 94
PpuMI RGGWCCY 1 cut(s) 145
Psp5II RGGWCCY 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 234
PspGI CCWGG 1 cut(s) 234
PspPI GGNCC 2 cut(s) 145, 238
PspPPI RGGWCCY 1 cut(s) 145
PstI CTGCAG 1 cut(s) 54
PvuII CAGCTG 1 cut(s) 92
SapI GCTCTTC 1 cut(s) 51
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 1 cut(s) 285
Sau96I GGNCC 2 cut(s) 145, 238
ScrFI CCNGG 1 cut(s) 236
SetI ASST 5 cut(s) 89, 94, 120, 150, 228
SfaNI GCATC 1 cut(s) 68
SfcI CTRYAG 2 cut(s) 50, 304
SinI GGWCC 1 cut(s) 145
SmlI CTYRAG 1 cut(s) 17
SmoI CTYRAG 1 cut(s) 17
Sse9I AATT 1 cut(s) 175
SsiI CCGC 1 cut(s) 215
StyD4I CCNGG 1 cut(s) 234
StyI CCWWGG 1 cut(s) 141
TaqI TCGA 2 cut(s) 189, 284
TasI AATT 1 cut(s) 175
TfiI GAWTC 2 cut(s) 29, 220
TseFI GTSAC 2 cut(s) 107, 226
TseI GCWGC 1 cut(s) 92
Tsp45I GTSAC 2 cut(s) 107, 226
VpaK11BI GGWCC 1 cut(s) 145
XagI CCTNNNNNAGG 1 cut(s) 20
XapI RAATTY 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.