Rmu_sc0006889.1_g000011

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006889.1
Physical Location & Seq
Forward (+)
34489 .. 34914
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006889.1_g000011.1.cds

Sequence Viewer

Length: 426 bp
atgaaaactgtcctatcaaggtttgggaaaacaggggtgactactagcaatgagagggatccaaatgataggatgttttctgttactgcagaggatgctgaatttgtaatggctattctgaatggatccccatggtcaattatgagatactctgttcgcttccaagagtggccagaatcttttgccattgaggaactacagtgcaatcagatagccttctgggtgcaaatcaggggagttccaccctatatgtttgatgtggagaatgtcagggagatggtggataactttggagagttcattaagatggatgaccctcttgaaggtgaagaaggcacctaccattttctctgtgttagaatccatcttgatgctcgtgatcccctacccacgggctatgaacttccaagagagaatggaacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

141

Amino Acids

16.35

Weight (kDa)

4.54

Isoelectric Point (pI)

27.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000073)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g17821 FvH4_2g04610 FvH4_2g09611 FvH4_2g13563 FvH4_3g21493 FvH4_3g32115 FvH4_3g35060 FvH4_4g00220 FvH4_4g06410 FvH4_4g10367 FvH4_4g10367 FvH4_4g10367 FvH4_5g06101 FvH4_5g08842 FvH4_5g27366 FvH4_5g31283 FvH4_6g11611 FvH4_6g23032 FvH4_7g05661 FvH4_7g06172
malus_domestica MD13G1263700.v1.1
prunus_persica Prupe.1G292300_v2.0.a1 Prupe.5G009700_v2.0.a1 Prupe.6G158100_v2.0.a1 Prupe.8G025100_v2.0.a1 Prupe.8G042600_v2.0.a1
pyrus_communis pycom02g02250 pycom02g16030 pycom05g10490 pycom09g06450 pycom09g06460 pycom13g26200 pycom16g17700
rosa_chinensis RchiOBHm_Chr2g0163321 RchiOBHm_Chr4g0401981 RchiOBHm_Chr5g0005991 RchiOBHm_Chr5g0027191 RchiOBHm_Chr6g0249771
rosa_laevigata RLG00000001040 RLG00000001764 RLG00000002239 RLG00000002240 RLG00000003259 RLG00000008993 RLG00000013847 RLG00000014178 RLG00000015576 RLG00000017269 RLG00000017355 RLG00000018127 RLG00000018602 RLG00000018615 RLG00000019904 RLG00000020044 RLG00000021849 RLG00000021850 RLG00000027965 RLG00000029266 RLG00000029820 RLG00000031112 RLG00000031915 RLG00000033568 RLG00000035013 RLG00000035677 RLG00000036568 RLG00000036628
rosa_multiflora Rmu_co8254085.1_g000001 Rmu_co8462383.1_g000001 Rmu_sc0000185.1_g000049 Rmu_sc0000251.1_g000018 Rmu_sc0000367.1_g000094 Rmu_sc0000498.1_g000023 Rmu_sc0000868.1_g000005 Rmu_sc0001521.1_g000047 Rmu_sc0001534.1_g000007 Rmu_sc0002014.1_g000012 Rmu_sc0003214.1_g000009 Rmu_sc0003573.1_g000041 Rmu_sc0003832.1_g000023 Rmu_sc0004677.1_g000015 Rmu_sc0004967.1_g000014 Rmu_sc0005426.1_g000001 Rmu_sc0005621.1_g000004 Rmu_sc0005640.1_g000009 Rmu_sc0005947.1_g000034 Rmu_sc0006889.1_g000011 Rmu_sc0007121.1_g000014 Rmu_sc0009191.1_g000017 Rmu_sc0010556.1_g000011 Rmu_sc0011396.1_g000007 Rmu_sc0019862.1_g000002 Rmu_sc0022931.1_g000003 Rmu_sc0024164.1_g000001 Rmu_ssc0000391.1_g000027
rosa_roxburghii Rroxscaffold_1G00050060 Rroxscaffold_1G00061810 Rroxscaffold_2G00109590 Rroxscaffold_2G00113810 Rroxscaffold_2G00124040 Rroxscaffold_2G00143620 Rroxscaffold_2G00154760 Rroxscaffold_4G00302820 Rroxscaffold_4G00302830 Rroxscaffold_4G00308680 Rroxscaffold_4G00310240 Rroxscaffold_4G00327890 Rroxscaffold_5G00334600 Rroxscaffold_5G00336050 Rroxscaffold_5G00346560 Rroxscaffold_5G00347860 Rroxscaffold_5G00347870 Rroxscaffold_5G00349330 Rroxscaffold_5G00351980 Rroxscaffold_6G00395280 Rroxscaffold_6G00396750 Rroxscaffold_6G00402910 Rroxscaffold_7G00174790 Rroxscaffold_7G00177570 Rroxscaffold_7G00191820 Rroxscaffold_7G00203480 Rroxscaffold_7G00204380
rosa_rugosa Rorug01G0106600 Rorug01G0106600 Rorug01G0148500.1 Rorug02G0224200 Rorug02G0225500 Rorug02G0233000 Rorug02G0630400 Rorug03G0198000 Rorug03G0232600.1 Rorug03G0240500 Rorug04G0032900 Rorug04G0073300 Rorug04G0118500 Rorug04G0149600.1 Rorug04G0205100 Rorug04G0256700 Rorug05G0020200 Rorug05G0050000 Rorug05G0247300 Rorug05G0295100 Rorug05G0337900 Rorug05G0542600 Rorug06G0034800 Rorug06G0035100 Rorug06G0220100 Rorug07G0091900 Rorug07G0271200
rosa_samantha Rh1AG118200 Rh1AG253000 Rh1AG296300 Rh1AG409000 Rh1AG410600 Rh1BG073400 Rh1BG130400 Rh1BG147300 Rh1BG163600 Rh1CG016000 Rh1DG012200 Rh1DG012300 Rh1DG078600 Rh1DG078800 Rh1DG138100 Rh1DG179200 Rh1DG192600 Rh1DG194500 Rh1DG194600 Rh1DG214300 Rh1DG245900 Rh1DG267000 Rh1DG322700 Rh1DG442700 Rh2AG282000 Rh2AG423000 Rh2AG423100 Rh2AG460700 Rh2AG466200 Rh2AG513400 Rh2AG547000 Rh2BG277800 Rh2BG281200 Rh2BG298300 Rh2BG304300 Rh2BG433500 Rh2CG276000 Rh2CG282600 Rh2CG325500 Rh2CG393000 Rh2DG319200 Rh2DG443400 Rh3AG169300 Rh3AG303600 Rh3BG195000 Rh3BG282600 Rh3BG343400 Rh3BG343500 Rh3BG344100 Rh3CG111700 Rh3CG185700 Rh3CG259100 Rh3CG293000 Rh3CG317900 Rh3CG340900 Rh3CG341000 Rh3CG341100 Rh3CG354700 Rh3CG359200 Rh3CG368100 Rh3DG179900 Rh3DG288700 Rh3DG302600 Rh3DG316000 Rh3DG324500 Rh3DG324600 Rh3DG343200 Rh3DG343300 Rh3DG362400 Rh4AG071800 Rh4BG034000 Rh4BG044300 Rh4BG044400 Rh4BG069600 Rh4BG157400 Rh4CG007000 Rh4CG030400 Rh4CG037900 Rh4CG077700 Rh4CG115000 Rh4CG162400 Rh4CG162500 Rh4CG165500 Rh4CG165600 Rh4CG172900 Rh4CG239700 Rh4DG055900 Rh4DG173200 Rh5AG354900 Rh5AG511100 Rh5BG112600 Rh5BG541000 Rh5BG541100 Rh5BG549300 Rh5CG004400 Rh5CG315000 Rh5CG563800 Rh5CG572100 Rh5DG112200 Rh5DG191300 Rh5DG407600 Rh5DG407700 Rh5DG567500 Rh6AG002600 Rh6AG051400 Rh6AG199800 Rh6AG199900 Rh6AG206200 Rh6AG391000 Rh6AG391100 Rh6BG007500 Rh6BG053400 Rh6BG225900 Rh6BG227100 Rh6BG232400 Rh6CG091100 Rh6CG125400 Rh6CG186700 Rh6CG222700 Rh6CG222800 Rh6CG235500 Rh6CG247200 Rh6CG331200 Rh6CG465100 Rh6DG183500 Rh6DG213500 Rh6DG238800 Rh6DG263700 Rh7AG211800 Rh7AG441800 Rh7BG008600 Rh7BG253000 Rh7BG390000 Rh7CG189600 Rh7CG401500 Rh7CG424200 Rh7CG428700 Rh7CG479800 Rh7CG494300 Rh7DG177000 Rh7DG218700 Rh7DG254000 Rh7DG294800 Rh7DG407200 Rh7DG448800 Rh7DG461500
rosa_wichuraiana Rw0G012180 Rw1G005270 Rw1G012310 Rw1G016890 Rw1G021700 Rw2G014380 Rw2G027690 Rw3G016400 Rw3G028230 Rw3G029320 Rw4G002060 Rw4G002100 Rw4G003980 Rw4G014140 Rw4G014770 Rw4G014780 Rw4G015760 Rw4G021230 Rw5G000520 Rw5G035610 Rw6G001680 Rw6G017890 Rw6G027440 Rw6G034130 Rw6G034170 Rw7G012430 Rw7G033870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 335
AclWI GGATC 5 cut(s) 53, 66, 120, 133, 374
AcoI YGGCCR 1 cut(s) 170
AcsI RAATTY 1 cut(s) 101
AfiI CCNNNNNNNGG 2 cut(s) 323, 391
AgsI TTSAA 1 cut(s) 323
AlwI GGATC 5 cut(s) 53, 66, 120, 133, 374
AoxI GGCC 1 cut(s) 170
ApoI RAATTY 1 cut(s) 101
AsuHPI GGTGA 2 cut(s) 49, 338
BalI TGGCCA 1 cut(s) 172
BamHI GGATCC 2 cut(s) 58, 125
BanI GGYRCC 1 cut(s) 335
BauI CACGAG 1 cut(s) 375
BccI CCATC 3 cut(s) 271, 301, 372
BfaI CTAG 2 cut(s) 45, 424
BfmI CTRYAG 2 cut(s) 87, 197
BmiI GGNNCC 4 cut(s) 60, 127, 337, 421
BmsI GCATC 2 cut(s) 85, 361
BsaJI CCNNGG 2 cut(s) 131, 390
Bsc4I CCNNNNNNNGG 2 cut(s) 323, 391
Bse3DI GCAATG 1 cut(s) 55
BseDI CCNNGG 2 cut(s) 131, 390
BseGI GGATG 3 cut(s) 78, 100, 316
BseLI CCNNNNNNNGG 2 cut(s) 323, 391
BseMI GCAATG 1 cut(s) 55
BshFI GGCC 1 cut(s) 172
BshNI GGYRCC 1 cut(s) 335
BslI CCNNNNNNNGG 2 cut(s) 323, 391
BsnI GGCC 1 cut(s) 172
Bsp143I GATC 3 cut(s) 58, 125, 379
Bsp19I CCATGG 1 cut(s) 131
BspANI GGCC 1 cut(s) 172
BspLI GGNNCC 4 cut(s) 60, 127, 337, 421
BspMAI CTGCAG 1 cut(s) 91
BspPI GGATC 5 cut(s) 53, 66, 120, 133, 374
BspT107I GGYRCC 1 cut(s) 335
BsrDI GCAATG 1 cut(s) 55
BssECI CCNNGG 2 cut(s) 131, 390
BssMI GATC 3 cut(s) 58, 125, 379
BssSI CACGAG 1 cut(s) 375
BssT1I CCWWGG 1 cut(s) 131
Bst2BI CACGAG 1 cut(s) 375
Bst4CI ACNGT 2 cut(s) 10, 201
BstAPI GCANNNNNTGC 1 cut(s) 95
BstDSI CCRYGG 2 cut(s) 131, 390
BstENI CCTNNNNNAGG 1 cut(s) 321
BstF5I GGATG 3 cut(s) 78, 100, 316
BstKTI GATC 3 cut(s) 61, 128, 382
BstMBI GATC 3 cut(s) 58, 125, 379
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstSFI CTRYAG 2 cut(s) 87, 197
BstX2I RGATCY 2 cut(s) 58, 125
BstYI RGATCY 2 cut(s) 58, 125
BsuRI GGCC 1 cut(s) 172
BtgI CCRYGG 2 cut(s) 131, 390
BtsCI GGATG 3 cut(s) 78, 100, 316
BtsIMutI CAGTG 1 cut(s) 206
CviAII CATG 1 cut(s) 132
CviJI RGCY 4 cut(s) 113, 172, 215, 396
CviKI_1 RGCY 4 cut(s) 113, 172, 215, 396
DpnI GATC 3 cut(s) 60, 127, 381
DpnII GATC 3 cut(s) 58, 125, 379
EaeI YGGCCR 1 cut(s) 170
Eco130I CCWWGG 1 cut(s) 131
EcoNI CCTNNNNNAGG 1 cut(s) 321
EcoT14I CCWWGG 1 cut(s) 131
ErhI CCWWGG 1 cut(s) 131
FaeI CATG 1 cut(s) 135
FaiI YATR 5 cut(s) 133, 143, 249, 251, 399
FatI CATG 1 cut(s) 131
FokI GGATG 3 cut(s) 85, 107, 323
FspBI CTAG 2 cut(s) 45, 424
HaeIII GGCC 1 cut(s) 172
Hin1II CATG 1 cut(s) 135
HinfI GANTC 2 cut(s) 176, 360
HphI GGTGA 2 cut(s) 49, 338
Hpy188I TCNGA 2 cut(s) 120, 210
Hpy188III TCNNGA 3 cut(s) 320, 368, 377
HpyAV CCTTC 3 cut(s) 226, 317, 326
HpyCH4III ACNGT 2 cut(s) 10, 201
HpyCH4V TGCA 3 cut(s) 89, 204, 226
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
Hsp92II CATG 1 cut(s) 135
Kzo9I GATC 3 cut(s) 58, 125, 379
LpnPI CCDG 5 cut(s) 18, 186, 205, 217, 256
LweI GCATC 2 cut(s) 85, 361
MaeI CTAG 2 cut(s) 45, 424
MaeIII GTNAC 2 cut(s) 37, 82
MalI GATC 3 cut(s) 60, 127, 381
MboI GATC 3 cut(s) 58, 125, 379
MboII GAAGA 1 cut(s) 341
MflI RGATCY 2 cut(s) 58, 125
MlsI TGGCCA 1 cut(s) 172
MluCI AATT 2 cut(s) 101, 138
MluNI TGGCCA 1 cut(s) 172
MnlI CCTC 4 cut(s) 48, 85, 184, 327
Mox20I TGGCCA 1 cut(s) 172
MscI TGGCCA 1 cut(s) 172
MseI TTAA 1 cut(s) 303
MslI CAYNNNNRTG 2 cut(s) 305, 369
Msp20I TGGCCA 1 cut(s) 172
MwoI GCNNNNNNNGC 1 cut(s) 95
NcoI CCATGG 1 cut(s) 131
NdeII GATC 3 cut(s) 58, 125, 379
NlaIII CATG 1 cut(s) 135
NlaIV GGNNCC 4 cut(s) 60, 127, 337, 421
NmuCI GTSAC 1 cut(s) 37
PfeI GAWTC 2 cut(s) 176, 360
PspN4I GGNNCC 4 cut(s) 60, 127, 337, 421
PstI CTGCAG 1 cut(s) 91
PsuI RGATCY 2 cut(s) 58, 125
RseI CAYNNNNRTG 2 cut(s) 305, 369
SaqAI TTAA 1 cut(s) 303
Sau3AI GATC 3 cut(s) 58, 125, 379
SetI ASST 4 cut(s) 23, 328, 341, 425
SfaNI GCATC 2 cut(s) 85, 361
SfcI CTRYAG 2 cut(s) 87, 197
SmiMI CAYNNNNRTG 2 cut(s) 305, 369
Sse9I AATT 2 cut(s) 101, 138
SspMI CTAG 2 cut(s) 45, 424
StyI CCWWGG 1 cut(s) 131
TaaI ACNGT 2 cut(s) 10, 201
TasI AATT 2 cut(s) 101, 138
TfiI GAWTC 2 cut(s) 176, 360
Tru1I TTAA 1 cut(s) 303
Tru9I TTAA 1 cut(s) 303
TscAI CASTG 1 cut(s) 206
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspDTI ATGAA 3 cut(s) 17, 289, 414
TspRI CASTG 1 cut(s) 206
XagI CCTNNNNNAGG 1 cut(s) 321
XapI RAATTY 1 cut(s) 101
XspI CTAG 2 cut(s) 45, 424
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.