Rmu_sc0000997.1_g000011

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000997.1
Physical Location & Seq
Reverse (-)
42295 .. 46467
4173 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000997.1_g000011.1.cds

Sequence Viewer

Length: 3855 bp
atggccgcttcttcttcttgctctgatagcatccctcaggagaagcatgatgtttttcttagtttcagaggcgaggacacccggaataatttcaccagccatctttatgaggctttatgtcagaaaaaaatccaaacttacatagattacaaactggagagaggggatgaaatctcacctgcccttttcaaagcaattgaagaatcgaagctttcggttatcattttctccgaaaactatgcttcttctacatggtgcttggatgaacttgcacacatactcgaatgcagagataaagcgcacatactcgaatccagaggtgaacagtttgttatacccatcttctacggcgtagatccatcagatgtacgcaaacaatttgggagttatgcagatgcatttgttgaacatgagaaacgtttcaaggactcaatggacaaggtgctcaggtggagaaaggctttgacaacagtagccaatatatctgggtttgattcccaaacaattaggctcgagtctgaattagttaagagggtggtcaatgacattttggcgaaattggatggcaaatcgcaaaacgcaggtggtttggagcgctgggttggaatggacaaacacataattcaacttgttgagttattatgcctcaactcacgggatgtccacattgtaggcatttggggtatgggtggtatcggtaagaccaccattgctgatgctgtatttcaccgtctctcttttgaattcgaagcttgctgctttattaaagatgttagggaaaaagcatcagagacgaaacatggactaccatatgatttgcgaaatgatctttttcgtactttactaaaggatgaagaaatacgcatagacaccccctctatcggatcaacttttatgagagacaggcttggccgtacaaaggctctcattgttcttgatgatgtgagtgagttttcccaattagaattttttgctggaggcgatttcaatctgtttggccctggaagtagaatcctaataacaaccagaaataaacgcatatttaggagtagtgttgataattataagatatatgaggttaaggaattagacaatgatgaagctcttaagctctttcatttgacagcttttagaaataagtctcccccgggtgattatacaacttttgcaaaagaggtggtagattatgctggaggcaatccattggctcttacaatcttcggctccgtaatattctgtcattgcaagagcaaagaagactgggaaaatgcattacgtaaattgaaaaaatatcctaacgaaagaatccagaatgtattgagattcagttatgatggattagaaaaaaatgagagggagatatttctcgatatcgcctgttatcacaaagggaagcgtattgatgaggcaaaaagaattttagatgaatgtttttgtgccgaagaaggagtaaaaattctcgttgatatgtctctcatatccgtaggtaaatattcaacacttacgatgcatgatttgatacaagaaatgggttgggaaattgttcgtgaaaaacgcagtagattgtggcttgcaaatgatgttcgtcgtgtactgacaaataacacgggtactgaagacattgagtgcatggccatgaatatggatctcattaaagattcatatgtgaatgttgcatccttcgaaaagatggataagctaagattactagatctatactcagactcggacaccaggggtgtcaacaaattgcaccttcctacaggtttcgagtttctccctgaggcccttaaatatctgaggtggcatttctatcctttgacatctctgccatcgaggttttctccagaaaatcttgtcgagcttgatatgcccaacagccgacttgagcaactttggaataaaggcgtgcagatcaatcttgggagcataaaacatatcgatcttagacactccgagcacctggctgatgtttcagctctgattgagagtccaaatctcgagagcattatccttgcgggttgtgaaagtttggttcaacttccttcatcgtttcagaatcttgccaagcttacttatcttgatctggatggttgctccaatctcaaaattctctcagagatgccaggcaatctggaagtcttaatgttggaacggactgcaatagaagaattgccttcatcaatttggtctctcgagaagcttcattatttggatcttaacagatgtgaagagcttaagaatcttccaagcagcacttgtaggttgaattcgctccaacgtcttaaagtatttggctgccgctctcttgagtctttgcctgtcgagctaccttctgcgctgaaggaattgtacttgagcgattgtgagagtcttgggtctttgcctgtcgagctaccttctgcgctgaaggaattgtacttgagcgattgtgagagtcttgggtctttgcctgtcgagctaccttctgcgctgaaggaattgtacttgagcgattgtgagagtcttgggtctttgcctgcccagctaccttctgggctgaagagactggagttgagaaattgcaagagtcttgggtctttgcctgtcgagctaccttctgggctgaagaaactgaacttgatctattgcaagagtcttgggtctttgcctgtcgagctaccttctgggctggagtacctgggcttgagcaattgtgggagtcttgagtctttgcctgtcgagctaccttctgggctggagtacctggacttgagcaattgtgagagtcttgagtctttgcctgtcgagctaccttctgggctgaagaaactgaacttgatctattgcaagagtcttgggtctttgcctgtcgagctaccttctgggctgaaggaactgaagttgatctattgccagagtcttgggtctttaccgaagctgccatggcttctagaactggttaatgcacatggctgcacgtcactagagacagtctcaagtccgatgaggactgcacccatacaaggtagggatcaatatgtcaaccattctcaagaattcgaggaactttcatttatgaattgcgtgaaattggatcagagtgcacggagcaacataatggctgatgcacagcttagagttatgcgatttgcaactgcatcacgtctccccaataataaacccagtacgactaatattgtttgtccgggaaatgaaattccaaagtggatgaggtatcaaagtgagggatgttcgataaatatcaagcttcctcctcattggtttcgtcaaggcttcatcggttacgctctatgcattgtggttgctttcaacaactatatgccaccatcggatattgaaaattattccttctttgattgggaaacccatcacaaaactaacaatagtcacgaagtttgttgcgaaggcctcgttatatgcctaccagctattctcatcaattcagatcatgtgttcgtgtggtatttctgccctgaatttgttcgattagaaagtgcaatcaatcgtgaggattgggtaaaagcatccgaggcctcttttgacttcaagttctacgaagatagtatttacaccccaaaagaaggaaatctctctgacccctccactgtgagggtgaaaaggtgtggagtctccttgttgtatgcccaagagattgaaaaattacttggaggcattgatgaagatgaagttatggaacgaaaacaagcagtagaagaagaagatatcatcatcaaaactaagcgacggcgggacgagtctgagctcagtggaagtggaactgcaagcttcaaaggagactataacgacctactacctccccagagtagtaaaaggaaaatctacgtcatgtga

Protein Analysis

1284

Amino Acids

145.49

Weight (kDa)

5.38

Isoelectric Point (pI)

54.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000020)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g26600 FvH4_2g27070 FvH4_2g27070 FvH4_2g27070 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27701 FvH4_2g27720 FvH4_3g05740 FvH4_3g05740 FvH4_3g05740 FvH4_3g05740 FvH4_3g15720 FvH4_5g35770 FvH4_5g35770 FvH4_5g35770 FvH4_5g35770 FvH4_5g35770 FvH4_6g34390 FvH4_6g34410 FvH4_6g34410
malus_domestica MD02G1278900.v1.1 MD03G1127300.v1.1 MD04G1027100.v1.1 MD04G1035000.v1.1 MD04G1035200.v1.1 MD04G1035600.v1.1 MD04G1036000.v1.1 MD04G1036100.v1.1 MD04G1036400.v1.1 MD05G1125400.v1.1 MD05G1125600.v1.1 MD05G1125700.v1.1 MD05G1126000.v1.1 MD05G1131900.v1.1 MD05G1132400.v1.1 MD05G1132600.v1.1 MD05G1132800.v1.1 MD05G1135700.v1.1 MD05G1135800.v1.1 MD05G1136700.v1.1 MD05G1137400.v1.1 MD05G1137900.v1.1 MD05G1138300.v1.1 MD05G1138400.v1.1 MD05G1138500.v1.1 MD05G1141700.v1.1 MD05G1142600.v1.1 MD05G1143300.v1.1 MD05G1145200.v1.1 MD05G1146500.v1.1 MD05G1146600.v1.1 MD05G1147100.v1.1 MD05G1147500.v1.1 MD05G1147600.v1.1 MD05G1148300.v1.1 MD05G1148600.v1.1 MD05G1149400.v1.1 MD05G1149500.v1.1 MD05G1150100.v1.1 MD05G1150200.v1.1 MD05G1150900.v1.1 MD05G1151200.v1.1 MD08G1168700.v1.1 MD10G1128400.v1.1 MD10G1128500.v1.1 MD10G1128600.v1.1 MD10G1134800.v1.1 MD10G1135300.v1.1 MD10G1135800.v1.1 MD10G1135900.v1.1 MD10G1136100.v1.1 MD10G1136200.v1.1 MD10G1136400.v1.1 MD10G1136500.v1.1 MD10G1136600.v1.1 MD10G1137100.v1.1 MD10G1137400.v1.1 MD10G1137500.v1.1 MD10G1137700.v1.1 MD10G1140900.v1.1 MD10G1141100.v1.1 MD10G1141400.v1.1 MD12G1073200.v1.1 MD12G1074900.v1.1 MD16G1140700.v1.1
prunus_persica Prupe.1G160400_v2.0.a1 Prupe.1G160500_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G083200_v2.0.a1 Prupe.6G152300_v2.0.a1 Prupe.8G037000_v2.0.a1 Prupe.8G117300_v2.0.a1 Prupe.8G117700_v2.0.a1 Prupe.8G118900_v2.0.a1 Prupe.8G173600_v2.0.a1 Prupe.8G173700_v2.0.a1 Prupe.8G176400_v2.0.a1 Prupe.8G179400_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G237200_v2.0.a1 Prupe.I001800_v2.0.a1 Prupe.I002000_v2.0.a1 Prupe.I002100_v2.0.a1 Prupe.I002200_v2.0.a1 Prupe.I002300_v2.0.a1 Prupe.I002300_v2.0.a1 Prupe.I002300_v2.0.a1
pyrus_communis pycom02g10490 pycom03g08410 pycom04g02350 pycom04g02370 pycom04g02890 pycom04g02920 pycom04g02930 pycom05g09430 pycom05g11970 pycom05g11980 pycom05g12000 pycom05g12010 pycom05g12040 pycom05g12080 pycom05g12100 pycom05g12110 pycom05g12160 pycom05g12910 pycom05g12920 pycom05g12940 pycom05g13220 pycom05g13230 pycom05g13260 pycom05g13300 pycom05g13320 pycom05g13330 pycom05g13350 pycom05g13680 pycom05g13710 pycom05g13720 pycom05g13730 pycom05g14120 pycom05g14130 pycom05g14160 pycom05g14210 pycom05g14250 pycom05g14280 pycom05g14290 pycom05g14340 pycom05g14390 pycom05g14430 pycom05g14460 pycom05g14530 pycom05g14560 pycom05g14570 pycom05g14580 pycom10g11010 pycom10g11020 pycom10g11030 pycom10g11250 pycom10g11640 pycom10g11670 pycom10g11680 pycom10g11720 pycom10g11730 pycom10g11950 pycom10g11960 pycom10g12000 pycom10g12050 pycom10g12070 pycom10g12310
rosa_chinensis RchiOBHm_Chr1g0314371 RchiOBHm_Chr1g0314461 RchiOBHm_Chr1g0314491 RchiOBHm_Chr1g0314661 RchiOBHm_Chr1g0314671 RchiOBHm_Chr1g0314701 RchiOBHm_Chr1g0314711 RchiOBHm_Chr1g0314741 RchiOBHm_Chr1g0327611 RchiOBHm_Chr1g0333931 RchiOBHm_Chr1g0334091 RchiOBHm_Chr1g0334101 RchiOBHm_Chr2g0144731 RchiOBHm_Chr2g0144751 RchiOBHm_Chr3g0451471 RchiOBHm_Chr3g0451481 RchiOBHm_Chr3g0451521 RchiOBHm_Chr3g0451541 RchiOBHm_Chr3g0451581 RchiOBHm_Chr3g0451641 RchiOBHm_Chr3g0451661 RchiOBHm_Chr3g0451671 RchiOBHm_Chr3g0484861 RchiOBHm_Chr5g0013861 RchiOBHm_Chr5g0013871 RchiOBHm_Chr5g0013881 RchiOBHm_Chr5g0013921 RchiOBHm_Chr5g0013931 RchiOBHm_Chr5g0026001 RchiOBHm_Chr5g0026101 RchiOBHm_Chr5g0026421 RchiOBHm_Chr5g0066271 RchiOBHm_Chr6g0287411 RchiOBHm_Chr6g0287421 RchiOBHm_Chr6g0287561 RchiOBHm_Chr6g0287581 RchiOBHm_Chr6g0287591 RchiOBHm_Chr6g0296221 RchiOBHm_Chr7g0237431
rosa_laevigata RLG00000001003 RLG00000011679 RLG00000011716 RLG00000012483 RLG00000012484 RLG00000013019 RLG00000015060 RLG00000020104 RLG00000020105 RLG00000020106 RLG00000020107 RLG00000020108 RLG00000020109 RLG00000023202 RLG00000024217 RLG00000025656 RLG00000025657 RLG00000026224 RLG00000029504 RLG00000029507 RLG00000029508 RLG00000029509 RLG00000029980 RLG00000030042 RLG00000032050 RLG00000032051 RLG00000032052 RLG00000032891 RLG00000032896 RLG00000032900 RLG00000032901 RLG00000032930 RLG00000032931 RLG00000035381 RLG00000035383 RLG00000035847
rosa_multiflora Rmu_co7983036.1_g000001 Rmu_co8026080.1_g000001 Rmu_co8242645.1_g000001 Rmu_co8396077.1_g000001 Rmu_co8406137.1_g000001 Rmu_co8420673.1_g000001 Rmu_co8458221.1_g000001 Rmu_sc0000026.1_g000007 Rmu_sc0000795.1_g000054 Rmu_sc0000997.1_g000011 Rmu_sc0001689.1_g000014 Rmu_sc0001802.1_g000009 Rmu_sc0002354.1_g000053 Rmu_sc0002354.1_g000055 Rmu_sc0002806.1_g000016 Rmu_sc0002833.1_g000022 Rmu_sc0002843.1_g000009 Rmu_sc0002923.1_g000021 Rmu_sc0003020.1_g000017 Rmu_sc0003598.1_g000012 Rmu_sc0003598.1_g000013 Rmu_sc0003598.1_g000014 Rmu_sc0003598.1_g000015 Rmu_sc0003690.1_g000001 Rmu_sc0004708.1_g000014 Rmu_sc0004924.1_g000009 Rmu_sc0004924.1_g000018 Rmu_sc0004924.1_g000022 Rmu_sc0004924.1_g000026 Rmu_sc0004924.1_g000032 Rmu_sc0004924.1_g000033 Rmu_sc0004924.1_g000037 Rmu_sc0004924.1_g000039 Rmu_sc0004974.1_g000006 Rmu_sc0005581.1_g000001 Rmu_sc0005581.1_g000010 Rmu_sc0005803.1_g000021 Rmu_sc0006653.1_g000009 Rmu_sc0007029.1_g000008 Rmu_sc0009360.1_g000007 Rmu_sc0009360.1_g000012 Rmu_sc0009360.1_g000013 Rmu_sc0009360.1_g000015 Rmu_sc0009360.1_g000021 Rmu_sc0009360.1_g000033 Rmu_sc0009360.1_g000048 Rmu_sc0009360.1_g000049 Rmu_sc0009360.1_g000051 Rmu_sc0011096.1_g000005 Rmu_sc0016584.1_g000002 Rmu_sc0020815.1_g000001 Rmu_sc0020815.1_g000002 Rmu_sc0025510.1_g000001 Rmu_sc0026263.1_g000003 Rmu_sc0029456.1_g000001 Rmu_sc0029457.1_g000001 Rmu_sc0029568.1_g000001 Rmu_sc0032214.1_g000001 Rmu_sc0041321.1_g000001 Rmu_sc0042928.1_g000001 Rmu_ssc0000042.1_g000010 Rmu_ssc0000042.1_g000019 Rmu_ssc0000042.1_g000020 Rmu_ssc0000126.1_g000058
rosa_roxburghii Rroxscaffold_164G00436360 Rroxscaffold_164G00436400 Rroxscaffold_164G00436430 Rroxscaffold_164G00436440 Rroxscaffold_164G00436470 Rroxscaffold_1G00052970 Rroxscaffold_1G00062790 Rroxscaffold_1G00062820 Rroxscaffold_2G00100990 Rroxscaffold_2G00101010 Rroxscaffold_3G00224210 Rroxscaffold_4G00297610 Rroxscaffold_4G00317070 Rroxscaffold_4G00317100 Rroxscaffold_4G00317110 Rroxscaffold_4G00317120 Rroxscaffold_4G00322520 Rroxscaffold_4G00322530 Rroxscaffold_4G00323280 Rroxscaffold_4G00331920 Rroxscaffold_6G00410350 Rroxscaffold_6G00428880 Rroxscaffold_6G00428910 Rroxscaffold_6G00428930 Rroxscaffold_7G00171360 Rroxscaffold_7G00171730 Rroxscaffold_7G00178330 Rroxscaffold_7G00178730 Rroxscaffold_7G00180960 Rroxscaffold_7G00181370
rosa_rugosa Rorug01G0001400 Rorug01G0001500 Rorug01G0001600 Rorug01G0001700 Rorug01G0068600 Rorug01G0068700 Rorug02G0389400 Rorug02G0389500 Rorug02G0634000 Rorug02G0634300 Rorug02G0634600 Rorug02G0634800 Rorug02G0634900 Rorug02G0634900 Rorug02G0635000 Rorug02G0635100 Rorug02G0635200 Rorug02G0635300 Rorug02G0635400 Rorug03G0213900 Rorug05G0012800 Rorug05G0012900 Rorug05G0013100 Rorug05G0013300 Rorug05G0090300 Rorug05G0090400 Rorug05G0092900 Rorug05G0093000 Rorug05G0093100 Rorug06G0189200 Rorug06G0189200 Rorug06G0189300 Rorug06G0189400 Rorug06G0259500 Rorug07G0303200 Rorug07G0303300.1
rosa_samantha Rh1AG010600 Rh1AG010900 Rh1AG011800 Rh1AG012100 Rh1AG012500 Rh1AG081000 Rh1AG085900 Rh1AG135300 Rh1AG135400 Rh1AG135500 Rh1AG135700 Rh1AG135800 Rh1AG136400 Rh1BG003400 Rh1BG003700 Rh1BG068500 Rh1BG103400 Rh1BG103500 Rh1BG103600 Rh1CG128600 Rh1CG128800 Rh1DG005800 Rh1DG090100 Rh1DG140800 Rh1DG140900 Rh1DG141100 Rh1DG141200 Rh1DG141500 Rh2AG441200 Rh2BG451500 Rh2BG451800 Rh2BG451900 Rh2CG428500 Rh2DG461500 Rh3AG037000 Rh3AG037100 Rh3AG037200 Rh3BG037600 Rh3BG037700 Rh3BG037800 Rh3BG038100 Rh3BG299500 Rh3BG299800 Rh3BG299900 Rh3CG036200 Rh3CG036400 Rh3CG036500 Rh3CG036800 Rh3CG297200 Rh3DG037100 Rh3DG037200 Rh3DG037400 Rh3DG293200 Rh5BG103800 Rh5BG104100 Rh5BG104200 Rh5BG180100 Rh5BG180200 Rh5BG183000 Rh5BG451600 Rh5CG115600 Rh5CG115700 Rh5CG115900 Rh5CG116100 Rh5CG198800 Rh5CG199300 Rh5CG202400 Rh5DG102100 Rh5DG102200 Rh5DG102300 Rh5DG102600 Rh5DG102800 Rh5DG181100 Rh5DG181300 Rh5DG181800 Rh5DG184900 Rh5DG185100 Rh6AG256000 Rh6AG299200 Rh6AG299300 Rh6AG300400 Rh6AG371800 Rh6BG383300 Rh6CG303400 Rh6CG314400 Rh6CG385000 Rh6DG297800 Rh6DG372300 Rh7BG046900 Rh7BG312300 Rh7BG312500 Rh7BG430400
rosa_wichuraiana Rw0G009620 Rw0G015730 Rw1G000490 Rw1G006410 Rw1G006700 Rw1G011270 Rw1G011280 Rw1G011310 Rw2G036080 Rw3G002740 Rw3G002750 Rw3G002760 Rw3G002770 Rw3G023580 Rw5G009360 Rw5G009370 Rw5G009380 Rw5G009390 Rw5G009400 Rw5G016550 Rw5G016890 Rw5G016910 Rw5G040760 Rw6G022190 Rw6G025910 Rw6G032400 Rw6G032690 Rw6G032790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1065
AarI CACCTGC 2 cut(s) 187, 572
Acc36I ACCTGC 2 cut(s) 187, 572
AccBSI CCGCTC 1 cut(s) 2304
AciI CCGC 4 cut(s) 6, 2018, 2302, 3751
AclI AACGTT 1 cut(s) 418
AclWI GGATC 6 cut(s) 350, 892, 1653, 2223, 3021, 3084
AcoI YGGCCR 3 cut(s) 3, 910, 1632
AcsI RAATTY 9 cut(s) 743, 965, 1416, 1455, 2109, 2269, 3038, 3198, 3479
AcuI CTGAAG 9 cut(s) 1635, 2363, 2429, 2495, 2561, 2627, 2825, 2891, 2900
AfeI AGCGCT 1 cut(s) 596
AfiI CCNNNNNNNGG 5 cut(s) 881, 919, 3005, 3584, 3612
AflII CTTAAG 2 cut(s) 1106, 2237
AjiI CACGTC 2 cut(s) 2961, 3146
AjnI CCWGG 6 cut(s) 1000, 1733, 1962, 2125, 2679, 2745
AjuI GAANNNNNNNTTGG 2 cut(s) 3651, 3683
Alw21I GWGCWC 4 cut(s) 447, 1962, 3088, 3768
Alw44I GTGCAC 1 cut(s) 3084
AlwI GGATC 6 cut(s) 350, 892, 1653, 2223, 3021, 3084
Ama87I CYCGRG 4 cut(s) 512, 1147, 2000, 2195
Aor51HI AGCGCT 1 cut(s) 596
AoxI GGCC 7 cut(s) 3, 910, 997, 1632, 1785, 3409, 3534
ApaLI GTGCAC 1 cut(s) 3084
ApeKI GCWGC 5 cut(s) 756, 2253, 2298, 2920, 2955
ApoI RAATTY 9 cut(s) 743, 965, 1416, 1455, 2109, 2269, 3038, 3198, 3479
Asp700I GAANNNNTTC 4 cut(s) 89, 419, 1542, 3483
AspLEI GCGC 5 cut(s) 301, 597, 2341, 2407, 2473
AspS9I GGNCC 2 cut(s) 998, 1786
AsuC2I CCSGG 4 cut(s) 82, 1148, 1149, 3189
AsuHPI GGTGA 6 cut(s) 85, 168, 332, 719, 1163, 3628
AsuII TTCGAA 2 cut(s) 747, 1683
AvaI CYCGRG 4 cut(s) 512, 1147, 2000, 2195
AxyI CCTNAGG 2 cut(s) 36, 1782
BaeGI GKGCMC 1 cut(s) 3088
BalI TGGCCA 1 cut(s) 1634
BanII GRGCYC 1 cut(s) 3768
BarI GAAGNNNNNNTAC 6 cut(s) 2336, 2368, 2402, 2434, 2468, 2500
BbsI GAAGAC 2 cut(s) 1263, 1623
Bbv12I GWGCWC 4 cut(s) 447, 1962, 3088, 3768
BbvI GCAGC 5 cut(s) 743, 2265, 2285, 2907, 2942
BceAI ACGGC 3 cut(s) 364, 897, 3764
BcgI CGANNNNNNTGC 2 cut(s) 221, 255
BciT130I CCWGG 6 cut(s) 1002, 1735, 1964, 2127, 2681, 2747
BcnI CCSGG 4 cut(s) 82, 1148, 1149, 3189
BfaI CTAG 3 cut(s) 1709, 2933, 2966
BfmI CTRYAG 1 cut(s) 1761
BfoI RGCGCY 1 cut(s) 598
BfrI CTTAAG 2 cut(s) 1106, 2237
BfuAI ACCTGC 2 cut(s) 187, 572
BglII AGATCT 1 cut(s) 1711
BisI GCNGC 7 cut(s) 6, 757, 2254, 2299, 2302, 2921, 2956
BlsI GCNGC 7 cut(s) 7, 758, 2255, 2300, 2303, 2922, 2957
BmeT110I CYCGRG 4 cut(s) 512, 1147, 2000, 2195
BmgBI CACGTC 2 cut(s) 2961, 3146
BmgT120I GGNCC 2 cut(s) 998, 1786
BmiI GGNNCC 1 cut(s) 1225
BmrI ACTGGG 2 cut(s) 1270, 3159
BmuI ACTGGG 2 cut(s) 1270, 3159
BpiI GAAGAC 2 cut(s) 1263, 1623
BplI GAGNNNNNCTC 4 cut(s) 1828, 1860, 2960, 2992
BpmI CTGGAG 7 cut(s) 176, 996, 1212, 1830, 2570, 2693, 2759
Bpu10I CCTNAGC 1 cut(s) 446
Bpu14I TTCGAA 2 cut(s) 747, 1683
BpuMI CCSGG 4 cut(s) 82, 1148, 1149, 3189
Bsa29I ATCGAT 1 cut(s) 1941
BsaAI YACGTR 1 cut(s) 1277
BsaBI GATNNNNATC 2 cut(s) 987, 3242
BsaI GGTCTC 1 cut(s) 2196
BsaJI CCNNGG 7 cut(s) 1000, 1146, 1147, 1734, 2680, 2924, 3531
Bsc4I CCNNNNNNNGG 5 cut(s) 881, 919, 3005, 3584, 3612
Bse1I ACTGG 5 cut(s) 159, 1265, 2553, 2943, 3165
Bse21I CCTNAGG 2 cut(s) 36, 1782
Bse3DI GCAATG 2 cut(s) 708, 1240
Bse8I GATNNNNATC 2 cut(s) 987, 3242
BseBI CCWGG 6 cut(s) 1002, 1735, 1964, 2127, 2681, 2747
BseCI ATCGAT 1 cut(s) 1941
BseDI CCNNGG 7 cut(s) 1000, 1146, 1147, 1734, 2680, 2924, 3531
BseJI GATNNNNATC 2 cut(s) 987, 3242
BseLI CCNNNNNNNGG 5 cut(s) 881, 919, 3005, 3584, 3612
BseMI GCAATG 2 cut(s) 708, 1240
BseMII CTCAG 8 cut(s) 50, 460, 1734, 1773, 1790, 2130, 3753, 3781
BseNI ACTGG 5 cut(s) 159, 1265, 2553, 2943, 3165
BseRI GAGGAG 1 cut(s) 3246
BseSI GKGCMC 1 cut(s) 3088
BseXI GCAGC 5 cut(s) 743, 2265, 2285, 2907, 2942
BseYI CCCAGC 2 cut(s) 597, 2523
BsgI GTGCAG 3 cut(s) 1931, 2941, 2979
BshFI GGCC 7 cut(s) 5, 912, 999, 1634, 1787, 3411, 3536
BshVI ATCGAT 1 cut(s) 1941
BsiHKAI GWGCWC 4 cut(s) 447, 1962, 3088, 3768
BsiHKCI CYCGRG 4 cut(s) 512, 1147, 2000, 2195
BsiSI CCGG 3 cut(s) 82, 1148, 3188
BslFI GGGAC 1 cut(s) 3767
BslI CCNNNNNNNGG 5 cut(s) 881, 919, 3005, 3584, 3612
BsmBI CGTCTC 3 cut(s) 737, 785, 3152
BsmFI GGGAC 1 cut(s) 3767
BsmI GAATGC 1 cut(s) 290
BsnI GGCC 7 cut(s) 5, 912, 999, 1634, 1787, 3411, 3536
Bso31I GGTCTC 1 cut(s) 2196
BsoBI CYCGRG 4 cut(s) 512, 1147, 2000, 2195
Bsp119I TTCGAA 2 cut(s) 747, 1683
Bsp1286I GDGCHC 4 cut(s) 447, 1962, 3088, 3768
Bsp19I CCATGG 1 cut(s) 2924
BspACI CCGC 4 cut(s) 6, 2018, 2302, 3751
BspANI GGCC 7 cut(s) 5, 912, 999, 1634, 1787, 3411, 3536
BspCNI CTCAG 8 cut(s) 49, 459, 1733, 1774, 1791, 2129, 3754, 3780
BspDI ATCGAT 1 cut(s) 1941
BspLI GGNNCC 1 cut(s) 1225
BspMI ACCTGC 2 cut(s) 187, 572
BspPI GGATC 6 cut(s) 350, 892, 1653, 2223, 3021, 3084
BspQI GCTCTTC 1 cut(s) 2226
BspT104I TTCGAA 2 cut(s) 747, 1683
BspTI CTTAAG 2 cut(s) 1106, 2237
BspTNI GGTCTC 1 cut(s) 2196
BsrBI CCGCTC 1 cut(s) 2304
BsrDI GCAATG 2 cut(s) 708, 1240
BsrI ACTGG 5 cut(s) 159, 1265, 2553, 2943, 3165
BssECI CCNNGG 7 cut(s) 1000, 1146, 1147, 1734, 2680, 2924, 3531
BssT1I CCWWGG 1 cut(s) 2924
Bst2UI CCWGG 6 cut(s) 1002, 1735, 1964, 2127, 2681, 2747
Bst4CI ACNGT 5 cut(s) 327, 472, 731, 2974, 3610
Bst6I CTCTTC 2 cut(s) 2226, 2537
BstAFI CTTAAG 2 cut(s) 1106, 2237
BstBAI YACGTR 1 cut(s) 1277
BstBI TTCGAA 2 cut(s) 747, 1683
BstC8I GCNNGC 5 cut(s) 754, 1572, 1910, 2520, 3787
BstDSI CCRYGG 1 cut(s) 2924
BstH2I RGCGCY 1 cut(s) 598
BstHHI GCGC 5 cut(s) 301, 597, 2341, 2407, 2473
BstNI CCWGG 6 cut(s) 1002, 1735, 1964, 2127, 2681, 2747
BstSFI CTRYAG 1 cut(s) 1761
BstSLI GKGCMC 1 cut(s) 3088
BstSNI TACGTA 1 cut(s) 1277
BstV1I GCAGC 5 cut(s) 743, 2265, 2285, 2907, 2942
BstV2I GAAGAC 2 cut(s) 1263, 1623
BstX2I RGATCY 4 cut(s) 355, 1645, 1711, 2215
BstXI CCANNNNNNTGG 2 cut(s) 1642, 2903
BstYI RGATCY 4 cut(s) 355, 1645, 1711, 2215
Bsu15I ATCGAT 1 cut(s) 1941
Bsu36I CCTNAGG 2 cut(s) 36, 1782
BsuRI GGCC 7 cut(s) 5, 912, 999, 1634, 1787, 3411, 3536
BsuTUI ATCGAT 1 cut(s) 1941
BtgI CCRYGG 1 cut(s) 2924
BtrI CACGTC 2 cut(s) 2961, 3146
BtsIMutI CAGTG 2 cut(s) 3606, 3775
BveI ACCTGC 2 cut(s) 187, 572
Cac8I GCNNGC 5 cut(s) 754, 1572, 1910, 2520, 3787
CfoI GCGC 5 cut(s) 301, 597, 2341, 2407, 2473
Cfr13I GGNCC 2 cut(s) 998, 1786
Cfr9I CCCGGG 1 cut(s) 1147
ClaI ATCGAT 1 cut(s) 1941
CspCI CAANNNNNGTGG 2 cut(s) 1158, 1193
EaeI YGGCCR 3 cut(s) 3, 910, 1632
Eam1104I CTCTTC 2 cut(s) 2226, 2537
EarI CTCTTC 2 cut(s) 2226, 2537
Ecl136II GAGCTC 1 cut(s) 3766
Eco105I TACGTA 1 cut(s) 1277
Eco130I CCWWGG 1 cut(s) 2924
Eco147I AGGCCT 2 cut(s) 3411, 3536
Eco24I GRGCYC 1 cut(s) 3768
Eco31I GGTCTC 1 cut(s) 2196
Eco32I GATATC 2 cut(s) 1372, 3727
Eco47III AGCGCT 1 cut(s) 596
Eco53kI GAGCTC 1 cut(s) 3766
Eco57I CTGAAG 9 cut(s) 1635, 2363, 2429, 2495, 2561, 2627, 2825, 2891, 2900
Eco81I CCTNAGG 2 cut(s) 36, 1782
Eco88I CYCGRG 4 cut(s) 512, 1147, 2000, 2195
EcoICRI GAGCTC 1 cut(s) 3766
EcoO109I RGGNCCY 1 cut(s) 1786
EcoRI GAATTC 3 cut(s) 743, 2269, 3038
EcoRII CCWGG 6 cut(s) 1000, 1733, 1962, 2125, 2679, 2745
EcoRV GATATC 2 cut(s) 1372, 3727
EcoT14I CCWWGG 1 cut(s) 2924
EcoT22I ATGCAT 4 cut(s) 400, 1273, 1512, 3299
EcoT38I GRGCYC 1 cut(s) 3768
ErhI CCWWGG 1 cut(s) 2924
Esp3I CGTCTC 3 cut(s) 737, 785, 3152
FalI AAGNNNNNCTT 2 cut(s) 2242, 2274
FaqI GGGAC 1 cut(s) 3767
FauI CCCGC 2 cut(s) 2011, 3744
FauNDI CATATG 2 cut(s) 811, 1663
Fnu4HI GCNGC 7 cut(s) 6, 757, 2254, 2299, 2302, 2921, 2956
FriOI GRGCYC 1 cut(s) 3768
Fsp4HI GCNGC 7 cut(s) 6, 757, 2254, 2299, 2302, 2921, 2956
FspBI CTAG 3 cut(s) 1709, 2933, 2966
GlaI GCGC 5 cut(s) 300, 596, 2340, 2406, 2472
GluI GCNGC 7 cut(s) 6, 757, 2254, 2299, 2302, 2921, 2956
GsaI CCCAGC 2 cut(s) 601, 2527
GsuI CTGGAG 7 cut(s) 176, 996, 1212, 1830, 2570, 2693, 2759
HaeII RGCGCY 1 cut(s) 598
HaeIII GGCC 7 cut(s) 5, 912, 999, 1634, 1787, 3411, 3536
HapII CCGG 3 cut(s) 82, 1148, 3188
HhaI GCGC 5 cut(s) 301, 597, 2341, 2407, 2473
Hin6I GCGC 5 cut(s) 299, 595, 2339, 2405, 2471
HinP1I GCGC 5 cut(s) 299, 595, 2339, 2405, 2471
HincII GTYRAC 2 cut(s) 1744, 3025
HindII GTYRAC 2 cut(s) 1744, 3025
HindIII AAGCTT 6 cut(s) 209, 750, 2069, 2201, 3248, 3787
HpaII CCGG 3 cut(s) 82, 1148, 3188
HphI GGTGA 6 cut(s) 85, 168, 332, 719, 1163, 3628
Hpy166II GTNNAC 6 cut(s) 323, 664, 1592, 1744, 3025, 3086
Hpy8I GTNNAC 6 cut(s) 323, 664, 1592, 1744, 3025, 3086
Hpy99I CGWCG 2 cut(s) 1590, 3750
HpyCH4III ACNGT 5 cut(s) 327, 472, 731, 2974, 3610
HpyCH4IV ACGT 6 cut(s) 418, 1276, 2281, 2960, 3145, 3846
HpySE526I ACGT 6 cut(s) 418, 1276, 2281, 2960, 3145, 3846
HspAI GCGC 5 cut(s) 299, 595, 2339, 2405, 2471
LguI GCTCTTC 1 cut(s) 2226
LmnI GCTCC 6 cut(s) 592, 1229, 1926, 2102, 2280, 3090
Lsp1109I GCAGC 5 cut(s) 743, 2265, 2285, 2907, 2942
MaeI CTAG 3 cut(s) 1709, 2933, 2966
MaeII ACGT 6 cut(s) 418, 1276, 2281, 2960, 3145, 3846
MaeIII GTNAC 3 cut(s) 2961, 3284, 3389
MbiI CCGCTC 1 cut(s) 2304
MfeI CAATTG 3 cut(s) 195, 2692, 2758
MflI RGATCY 4 cut(s) 355, 1645, 1711, 2215
MhlI GDGCHC 4 cut(s) 447, 1962, 3088, 3768
MlsI TGGCCA 1 cut(s) 1634
MluNI TGGCCA 1 cut(s) 1634
MmeI TCCRAC 3 cut(s) 583, 2130, 2302
Mox20I TGGCCA 1 cut(s) 1634
Mph1103I ATGCAT 4 cut(s) 400, 1273, 1512, 3299
MroXI GAANNNNTTC 4 cut(s) 89, 419, 1542, 3483
MscI TGGCCA 1 cut(s) 1634
MslI CAYNNNNRTG 3 cut(s) 105, 1634, 1640
Msp20I TGGCCA 1 cut(s) 1634
MspCI CTTAAG 2 cut(s) 1106, 2237
MspI CCGG 3 cut(s) 82, 1148, 3188
MunI CAATTG 3 cut(s) 195, 2692, 2758
Mva1269I GAATGC 1 cut(s) 290
MvaI CCWGG 6 cut(s) 1002, 1735, 1964, 2127, 2681, 2747
NciI CCSGG 4 cut(s) 82, 1148, 1149, 3189
NcoI CCATGG 1 cut(s) 2924
NdeI CATATG 2 cut(s) 811, 1663
NlaIV GGNNCC 1 cut(s) 1225
NmuCI GTSAC 2 cut(s) 2961, 3389
NsiI ATGCAT 4 cut(s) 400, 1273, 1512, 3299
NspV TTCGAA 2 cut(s) 747, 1683
PaeR7I CTCGAG 3 cut(s) 512, 2000, 2195
PaqCI CACCTGC 2 cut(s) 187, 572
PceI AGGCCT 2 cut(s) 3411, 3536
PciSI GCTCTTC 1 cut(s) 2226
PctI GAATGC 1 cut(s) 290
PdmI GAANNNNTTC 4 cut(s) 89, 419, 1542, 3483
PfeI GAWTC 9 cut(s) 203, 311, 494, 1011, 1305, 1323, 1658, 2059, 2242
PfoI TCCNGGA 1 cut(s) 3187
PkrI GCNGC 7 cut(s) 7, 758, 2255, 2300, 2303, 2922, 2957
Ppu21I YACGTR 1 cut(s) 1277
PsiI TTATAA 1 cut(s) 1065
Psp124BI GAGCTC 1 cut(s) 3768
Psp1406I AACGTT 1 cut(s) 418
Psp6I CCWGG 6 cut(s) 1000, 1733, 1962, 2125, 2679, 2745
PspFI CCCAGC 2 cut(s) 597, 2523
PspGI CCWGG 6 cut(s) 1000, 1733, 1962, 2125, 2679, 2745
PspN4I GGNNCC 1 cut(s) 1225
PspPI GGNCC 2 cut(s) 998, 1786
PspXI VCTCGAGB 1 cut(s) 512
PsuI RGATCY 4 cut(s) 355, 1645, 1711, 2215
RseI CAYNNNNRTG 3 cut(s) 105, 1634, 1640
SacI GAGCTC 1 cut(s) 3768
SapI GCTCTTC 1 cut(s) 2226
SatI GCNGC 7 cut(s) 6, 757, 2254, 2299, 2302, 2921, 2956
Sau96I GGNCC 2 cut(s) 998, 1786
SduI GDGCHC 4 cut(s) 447, 1962, 3088, 3768
SfcI CTRYAG 1 cut(s) 1761
Sfr274I CTCGAG 3 cut(s) 512, 2000, 2195
SfuI TTCGAA 2 cut(s) 747, 1683
SlaI CTCGAG 3 cut(s) 512, 2000, 2195
SmaI CCCGGG 1 cut(s) 1149
SmiMI CAYNNNNRTG 3 cut(s) 105, 1634, 1640
SnaBI TACGTA 1 cut(s) 1277
SseBI AGGCCT 2 cut(s) 3411, 3536
SsiI CCGC 4 cut(s) 6, 2018, 2302, 3751
SspI AATATT 3 cut(s) 1233, 1493, 3178
SspMI CTAG 3 cut(s) 1709, 2933, 2966
SstI GAGCTC 1 cut(s) 3768
StuI AGGCCT 2 cut(s) 3411, 3536
StyI CCWWGG 1 cut(s) 2924
TaaI ACNGT 5 cut(s) 327, 472, 731, 2974, 3610
TaiI ACGT 6 cut(s) 421, 1279, 2284, 2963, 3148, 3849
TatI WGTACW 4 cut(s) 1591, 2352, 2418, 2484
TauI GCSGC 2 cut(s) 8, 2304
TfiI GAWTC 9 cut(s) 203, 311, 494, 1011, 1305, 1323, 1658, 2059, 2242
TscAI CASTG 2 cut(s) 3613, 3775
TseFI GTSAC 2 cut(s) 2961, 3389
TseI GCWGC 5 cut(s) 756, 2253, 2298, 2920, 2955
Tsp45I GTSAC 2 cut(s) 2961, 3389
TspGWI ACGGA 4 cut(s) 1216, 1471, 2170, 3103
TspMI CCCGGG 1 cut(s) 1147
TspRI CASTG 2 cut(s) 3613, 3775
Vha464I CTTAAG 2 cut(s) 1106, 2237
VneI GTGCAC 1 cut(s) 3084
XapI RAATTY 9 cut(s) 743, 965, 1416, 1455, 2109, 2269, 3038, 3198, 3479
XbaI TCTAGA 1 cut(s) 2932
XcmI CCANNNNNNNNNTGG 1 cut(s) 2531
XhoI CTCGAG 3 cut(s) 512, 2000, 2195
XmaI CCCGGG 1 cut(s) 1147
XmnI GAANNNNTTC 4 cut(s) 89, 419, 1542, 3483
XspI CTAG 3 cut(s) 1709, 2933, 2966
Zsp2I ATGCAT 4 cut(s) 400, 1273, 1512, 3299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.