Rmu_sc0003020.1_g000017

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003020.1
Physical Location & Seq
Reverse (-)
102410 .. 106476
4067 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003020.1_g000017.1.cds

Sequence Viewer

Length: 3651 bp
atggctgccgcttcttcttgctctgatatcagccgtcgagagaagcatgatgtatttcttagtttcagaggtgaggacacccggaatacttttaccagccatctttatgaggctttacgtcagaaaaaaatccaaacttacatagatgacaaactggagagaggagatgaaatctcaccggcccttctcaaagcaatcagcgaatcgaagctttcggttatcattttctccaaaaactatgcttcttctacatggtgcttggatgaacttgtgcacatactccaatgcagaggtgaacagattgttatacccatcttctacggcatagatccatcagttgtacgcaaacaatcggggatttatgcagatgcatttgttcaacatgaggagagtttcaagggcacaaaggaggacaaggtgctggcatggagaggtgcgttgaaaacagcagcggatatatctggatttgattcccaaacaattagaggtgaacagattgttatacccatcttctacggcatagatccatcagttgtacgcaaacaatcggggatttatgcagatgcatttgttcaacatgaggagagtttcaagggcacgaaggaggacaaggtgctggcatggagaggtgcgttgaaaacagcagcggatatatctggatttgattcccaaacaattaggcccgagtctgatttagttaaggttgtggtcaatgacattttggagaaattgaatcgcaaattgcaaatcgcacggggtttaaagggcctggttggaatggaaaaacacattcaacaagttgaattgttattatgtctcaactcactggatgtccagattgtaggtatttggggtatgggtggtatcggtaagaccaccattgctgaggttgtatttgatcgactctcttctcaattcgaagcttgctgctttattgcaaatgtcagggaatcagaggcgaaacatggactaaatgatttgtggaatcagattcttcgtacactactgaaggaagaaaatctatgtatggccactccatctattatatcaacttttgcacgagagaggcttcgccgtacgaagtccctcattgttcttgatgatgtgagtgagctttcccaattagaacctttagctggaggtgattgcaatatgtttggccctggaagtagaatccttgtaacaaccagaaataaacgcatatttaggaatggtgctgatgatgataagatatatgaagttaaggaattagaggttgatgaagctcttgagctctttcatttgatagcttttagaaataagtctcccccaggtgattatacaacttttgcaaaagaggtggtagattatgctcgaggcaatccattggctcttaaaatcttggcttccgtattctctaattgcaggagcaaagaagactgggaaagtgagttggataaagtgaaaaaatttcccaaccaaaatatccagaatgtattgaggttgagttatgatggattacatcaaaatgagaaggatatatttctcgacatcgcatgttactataaaggagagtgtatagctgatgcaaaaagaatgttagatgcctctggcttctgtgcaaatgcaggaataagacttctcatcgatatgtctctcatatcaataaagggtcattttccaacagtagagatgcatgatttgatacaagaaatgggtcagacaattgttctcgatgaatgcattaaagaccccggacaacgcagtagattgtggactgctaaggatgtcggttatgtactaaaacataagaggggaactcaagcaattgaatgcttagggatgaccatggatcccattacagattttgacataaatccttcagctttcaaaaagatgcataatctaagattacttaagttacagtttgagcgtcactcttactgggactcaaagtcatgggtcaacaaagttcgccttcctcagggtctcaagtgtcttcctcaagcccttagaatcctgcactgggatggctaccctttgaattctctgccatcaaagttttgtccagacaatcttgttgtgcttcatatgcaaggcagccaacttgagcgactttgggataaaggcctgaagatcagtcttgggagcttaaaagagatcgatcttcgtctgtccaagcacctggctgaggttccagatctctcagagagtccaaatctcgagagaattgatcttgaaggttgtacaagtttggttcaacttcctttgtcttttcagcatcttgccaagcttactcgtctccatctgaatgactgctccaatctcaaaattctcccagagatgccagacaatctgaaagtcttacgattggatcggactgcaatagaagaattgccttcatcaatttggtgtcacgagaagctttatgaattgaatcttggaacatgtaaagagcttaagaatattccaagcagcactcgtaggctgaattcgctcctacgtcttcgtctaaatagctgcctctctcttgaggagctaccttctcggctgatagaactggacttgagaaattgcaagagtcttgggtctttacctgtcgagctcccttctcggctgaggttcctgagcttggggtattgcaagagtcttgggtctttgcctgtcgagctcccttctgggctgatgtcactggacttgagaaattgcaagagtctggggtctttaccgaagctgccatggcttctaaaggagttggatgcacacggctgcacgtcactagagacagtctcaagttcgatgaggactgcacccatacaaggtcaggatcaatatgtccagtattgggaaaacatctggcctgggaatgaggaacttgtatttataaattgcgtgaaattggatcagagtgcacggagcaacataatggctgacgcacagcttacagttatgcgatttgcgtcacgtcgtcgcaagaaatggaatgggactaaaattgtttgtccgggaaatgaaattccaaagtgggtgaggtatcaaagtgagggatgttcgataaatatcaagcttcctcctcattcgtttcgtcaaggcttcctcggttacgctctatgcgttgtggttgcattcaacaactatacgccaccacccgatttcaagtatccctacttttgttgtggagcacatcacaaaactgacaatggtcacaaagagcggtgcgactgcgacctcgatataagcctaccagatgatataattctcaattcagatcatgtgttcctgtggtatttctgccctttttttgttcgatttggaatttcaatcaatcgcgaggattccgaggcctcttttgacttcatgttgtaccaacataccgaccggagcggcattggtgaaaacaaggagcccatcgacccctccactgtgagggtgaaaaggtgtggagtctccttgctgtatgcccaagatcttgaaaaattacttggaggcattgatgaacatgtagttatggaaccaaaacaagtagttgaagaagaagatttcatcatcaaaaccaagagaggacgggacgagtctgaacgcagtggaagtggaactactgcaagcttcaaagaagaagataacgaccaactacctccccagagtagtaaaaggaaaatcaacatcatgtga

Protein Analysis

1216

Amino Acids

137.82

Weight (kDa)

6.51

Isoelectric Point (pI)

47.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000020)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g26600 FvH4_2g27070 FvH4_2g27070 FvH4_2g27070 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27701 FvH4_2g27720 FvH4_3g05740 FvH4_3g05740 FvH4_3g05740 FvH4_3g05740 FvH4_3g15720 FvH4_5g35770 FvH4_5g35770 FvH4_5g35770 FvH4_5g35770 FvH4_5g35770 FvH4_6g34390 FvH4_6g34410 FvH4_6g34410
malus_domestica MD02G1278900.v1.1 MD03G1127300.v1.1 MD04G1027100.v1.1 MD04G1035000.v1.1 MD04G1035200.v1.1 MD04G1035600.v1.1 MD04G1036000.v1.1 MD04G1036100.v1.1 MD04G1036400.v1.1 MD05G1125400.v1.1 MD05G1125600.v1.1 MD05G1125700.v1.1 MD05G1126000.v1.1 MD05G1131900.v1.1 MD05G1132400.v1.1 MD05G1132600.v1.1 MD05G1132800.v1.1 MD05G1135700.v1.1 MD05G1135800.v1.1 MD05G1136700.v1.1 MD05G1137400.v1.1 MD05G1137900.v1.1 MD05G1138300.v1.1 MD05G1138400.v1.1 MD05G1138500.v1.1 MD05G1141700.v1.1 MD05G1142600.v1.1 MD05G1143300.v1.1 MD05G1145200.v1.1 MD05G1146500.v1.1 MD05G1146600.v1.1 MD05G1147100.v1.1 MD05G1147500.v1.1 MD05G1147600.v1.1 MD05G1148300.v1.1 MD05G1148600.v1.1 MD05G1149400.v1.1 MD05G1149500.v1.1 MD05G1150100.v1.1 MD05G1150200.v1.1 MD05G1150900.v1.1 MD05G1151200.v1.1 MD08G1168700.v1.1 MD10G1128400.v1.1 MD10G1128500.v1.1 MD10G1128600.v1.1 MD10G1134800.v1.1 MD10G1135300.v1.1 MD10G1135800.v1.1 MD10G1135900.v1.1 MD10G1136100.v1.1 MD10G1136200.v1.1 MD10G1136400.v1.1 MD10G1136500.v1.1 MD10G1136600.v1.1 MD10G1137100.v1.1 MD10G1137400.v1.1 MD10G1137500.v1.1 MD10G1137700.v1.1 MD10G1140900.v1.1 MD10G1141100.v1.1 MD10G1141400.v1.1 MD12G1073200.v1.1 MD12G1074900.v1.1 MD16G1140700.v1.1
prunus_persica Prupe.1G160400_v2.0.a1 Prupe.1G160500_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G083200_v2.0.a1 Prupe.6G152300_v2.0.a1 Prupe.8G037000_v2.0.a1 Prupe.8G117300_v2.0.a1 Prupe.8G117700_v2.0.a1 Prupe.8G118900_v2.0.a1 Prupe.8G173600_v2.0.a1 Prupe.8G173700_v2.0.a1 Prupe.8G176400_v2.0.a1 Prupe.8G179400_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G237200_v2.0.a1 Prupe.I001800_v2.0.a1 Prupe.I002000_v2.0.a1 Prupe.I002100_v2.0.a1 Prupe.I002200_v2.0.a1 Prupe.I002300_v2.0.a1 Prupe.I002300_v2.0.a1 Prupe.I002300_v2.0.a1
pyrus_communis pycom02g10490 pycom03g08410 pycom04g02350 pycom04g02370 pycom04g02890 pycom04g02920 pycom04g02930 pycom05g09430 pycom05g11970 pycom05g11980 pycom05g12000 pycom05g12010 pycom05g12040 pycom05g12080 pycom05g12100 pycom05g12110 pycom05g12160 pycom05g12910 pycom05g12920 pycom05g12940 pycom05g13220 pycom05g13230 pycom05g13260 pycom05g13300 pycom05g13320 pycom05g13330 pycom05g13350 pycom05g13680 pycom05g13710 pycom05g13720 pycom05g13730 pycom05g14120 pycom05g14130 pycom05g14160 pycom05g14210 pycom05g14250 pycom05g14280 pycom05g14290 pycom05g14340 pycom05g14390 pycom05g14430 pycom05g14460 pycom05g14530 pycom05g14560 pycom05g14570 pycom05g14580 pycom10g11010 pycom10g11020 pycom10g11030 pycom10g11250 pycom10g11640 pycom10g11670 pycom10g11680 pycom10g11720 pycom10g11730 pycom10g11950 pycom10g11960 pycom10g12000 pycom10g12050 pycom10g12070 pycom10g12310
rosa_chinensis RchiOBHm_Chr1g0314371 RchiOBHm_Chr1g0314461 RchiOBHm_Chr1g0314491 RchiOBHm_Chr1g0314661 RchiOBHm_Chr1g0314671 RchiOBHm_Chr1g0314701 RchiOBHm_Chr1g0314711 RchiOBHm_Chr1g0314741 RchiOBHm_Chr1g0327611 RchiOBHm_Chr1g0333931 RchiOBHm_Chr1g0334091 RchiOBHm_Chr1g0334101 RchiOBHm_Chr2g0144731 RchiOBHm_Chr2g0144751 RchiOBHm_Chr3g0451471 RchiOBHm_Chr3g0451481 RchiOBHm_Chr3g0451521 RchiOBHm_Chr3g0451541 RchiOBHm_Chr3g0451581 RchiOBHm_Chr3g0451641 RchiOBHm_Chr3g0451661 RchiOBHm_Chr3g0451671 RchiOBHm_Chr3g0484861 RchiOBHm_Chr5g0013861 RchiOBHm_Chr5g0013871 RchiOBHm_Chr5g0013881 RchiOBHm_Chr5g0013921 RchiOBHm_Chr5g0013931 RchiOBHm_Chr5g0026001 RchiOBHm_Chr5g0026101 RchiOBHm_Chr5g0026421 RchiOBHm_Chr5g0066271 RchiOBHm_Chr6g0287411 RchiOBHm_Chr6g0287421 RchiOBHm_Chr6g0287561 RchiOBHm_Chr6g0287581 RchiOBHm_Chr6g0287591 RchiOBHm_Chr6g0296221 RchiOBHm_Chr7g0237431
rosa_laevigata RLG00000001003 RLG00000011679 RLG00000011716 RLG00000012483 RLG00000012484 RLG00000013019 RLG00000015060 RLG00000020104 RLG00000020105 RLG00000020106 RLG00000020107 RLG00000020108 RLG00000020109 RLG00000023202 RLG00000024217 RLG00000025656 RLG00000025657 RLG00000026224 RLG00000029504 RLG00000029507 RLG00000029508 RLG00000029509 RLG00000029980 RLG00000030042 RLG00000032050 RLG00000032051 RLG00000032052 RLG00000032891 RLG00000032896 RLG00000032900 RLG00000032901 RLG00000032930 RLG00000032931 RLG00000035381 RLG00000035383 RLG00000035847
rosa_multiflora Rmu_co7983036.1_g000001 Rmu_co8026080.1_g000001 Rmu_co8242645.1_g000001 Rmu_co8396077.1_g000001 Rmu_co8406137.1_g000001 Rmu_co8420673.1_g000001 Rmu_co8458221.1_g000001 Rmu_sc0000026.1_g000007 Rmu_sc0000795.1_g000054 Rmu_sc0000997.1_g000011 Rmu_sc0001689.1_g000014 Rmu_sc0001802.1_g000009 Rmu_sc0002354.1_g000053 Rmu_sc0002354.1_g000055 Rmu_sc0002806.1_g000016 Rmu_sc0002833.1_g000022 Rmu_sc0002843.1_g000009 Rmu_sc0002923.1_g000021 Rmu_sc0003020.1_g000017 Rmu_sc0003598.1_g000012 Rmu_sc0003598.1_g000013 Rmu_sc0003598.1_g000014 Rmu_sc0003598.1_g000015 Rmu_sc0003690.1_g000001 Rmu_sc0004708.1_g000014 Rmu_sc0004924.1_g000009 Rmu_sc0004924.1_g000018 Rmu_sc0004924.1_g000022 Rmu_sc0004924.1_g000026 Rmu_sc0004924.1_g000032 Rmu_sc0004924.1_g000033 Rmu_sc0004924.1_g000037 Rmu_sc0004924.1_g000039 Rmu_sc0004974.1_g000006 Rmu_sc0005581.1_g000001 Rmu_sc0005581.1_g000010 Rmu_sc0005803.1_g000021 Rmu_sc0006653.1_g000009 Rmu_sc0007029.1_g000008 Rmu_sc0009360.1_g000007 Rmu_sc0009360.1_g000012 Rmu_sc0009360.1_g000013 Rmu_sc0009360.1_g000015 Rmu_sc0009360.1_g000021 Rmu_sc0009360.1_g000033 Rmu_sc0009360.1_g000048 Rmu_sc0009360.1_g000049 Rmu_sc0009360.1_g000051 Rmu_sc0011096.1_g000005 Rmu_sc0016584.1_g000002 Rmu_sc0020815.1_g000001 Rmu_sc0020815.1_g000002 Rmu_sc0025510.1_g000001 Rmu_sc0026263.1_g000003 Rmu_sc0029456.1_g000001 Rmu_sc0029457.1_g000001 Rmu_sc0029568.1_g000001 Rmu_sc0032214.1_g000001 Rmu_sc0041321.1_g000001 Rmu_sc0042928.1_g000001 Rmu_ssc0000042.1_g000010 Rmu_ssc0000042.1_g000019 Rmu_ssc0000042.1_g000020 Rmu_ssc0000126.1_g000058
rosa_roxburghii Rroxscaffold_164G00436360 Rroxscaffold_164G00436400 Rroxscaffold_164G00436430 Rroxscaffold_164G00436440 Rroxscaffold_164G00436470 Rroxscaffold_1G00052970 Rroxscaffold_1G00062790 Rroxscaffold_1G00062820 Rroxscaffold_2G00100990 Rroxscaffold_2G00101010 Rroxscaffold_3G00224210 Rroxscaffold_4G00297610 Rroxscaffold_4G00317070 Rroxscaffold_4G00317100 Rroxscaffold_4G00317110 Rroxscaffold_4G00317120 Rroxscaffold_4G00322520 Rroxscaffold_4G00322530 Rroxscaffold_4G00323280 Rroxscaffold_4G00331920 Rroxscaffold_6G00410350 Rroxscaffold_6G00428880 Rroxscaffold_6G00428910 Rroxscaffold_6G00428930 Rroxscaffold_7G00171360 Rroxscaffold_7G00171730 Rroxscaffold_7G00178330 Rroxscaffold_7G00178730 Rroxscaffold_7G00180960 Rroxscaffold_7G00181370
rosa_rugosa Rorug01G0001400 Rorug01G0001500 Rorug01G0001600 Rorug01G0001700 Rorug01G0068600 Rorug01G0068700 Rorug02G0389400 Rorug02G0389500 Rorug02G0634000 Rorug02G0634300 Rorug02G0634600 Rorug02G0634800 Rorug02G0634900 Rorug02G0634900 Rorug02G0635000 Rorug02G0635100 Rorug02G0635200 Rorug02G0635300 Rorug02G0635400 Rorug03G0213900 Rorug05G0012800 Rorug05G0012900 Rorug05G0013100 Rorug05G0013300 Rorug05G0090300 Rorug05G0090400 Rorug05G0092900 Rorug05G0093000 Rorug05G0093100 Rorug06G0189200 Rorug06G0189200 Rorug06G0189300 Rorug06G0189400 Rorug06G0259500 Rorug07G0303200 Rorug07G0303300.1
rosa_samantha Rh1AG010600 Rh1AG010900 Rh1AG011800 Rh1AG012100 Rh1AG012500 Rh1AG081000 Rh1AG085900 Rh1AG135300 Rh1AG135400 Rh1AG135500 Rh1AG135700 Rh1AG135800 Rh1AG136400 Rh1BG003400 Rh1BG003700 Rh1BG068500 Rh1BG103400 Rh1BG103500 Rh1BG103600 Rh1CG128600 Rh1CG128800 Rh1DG005800 Rh1DG090100 Rh1DG140800 Rh1DG140900 Rh1DG141100 Rh1DG141200 Rh1DG141500 Rh2AG441200 Rh2BG451500 Rh2BG451800 Rh2BG451900 Rh2CG428500 Rh2DG461500 Rh3AG037000 Rh3AG037100 Rh3AG037200 Rh3BG037600 Rh3BG037700 Rh3BG037800 Rh3BG038100 Rh3BG299500 Rh3BG299800 Rh3BG299900 Rh3CG036200 Rh3CG036400 Rh3CG036500 Rh3CG036800 Rh3CG297200 Rh3DG037100 Rh3DG037200 Rh3DG037400 Rh3DG293200 Rh5BG103800 Rh5BG104100 Rh5BG104200 Rh5BG180100 Rh5BG180200 Rh5BG183000 Rh5BG451600 Rh5CG115600 Rh5CG115700 Rh5CG115900 Rh5CG116100 Rh5CG198800 Rh5CG199300 Rh5CG202400 Rh5DG102100 Rh5DG102200 Rh5DG102300 Rh5DG102600 Rh5DG102800 Rh5DG181100 Rh5DG181300 Rh5DG181800 Rh5DG184900 Rh5DG185100 Rh6AG256000 Rh6AG299200 Rh6AG299300 Rh6AG300400 Rh6AG371800 Rh6BG383300 Rh6CG303400 Rh6CG314400 Rh6CG385000 Rh6DG297800 Rh6DG372300 Rh7BG046900 Rh7BG312300 Rh7BG312500 Rh7BG430400
rosa_wichuraiana Rw0G009620 Rw0G015730 Rw1G000490 Rw1G006410 Rw1G006700 Rw1G011270 Rw1G011280 Rw1G011310 Rw2G036080 Rw3G002740 Rw3G002750 Rw3G002760 Rw3G002770 Rw3G023580 Rw5G009360 Rw5G009370 Rw5G009380 Rw5G009390 Rw5G009400 Rw5G016550 Rw5G016890 Rw5G016910 Rw5G040760 Rw6G022190 Rw6G025910 Rw6G032400 Rw6G032690 Rw6G032790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 2864
AccBSI CCGCTC 2 cut(s) 3193, 3363
AccII CGCG 1 cut(s) 3309
AciI CCGC 5 cut(s) 9, 452, 647, 3193, 3363
AclWI GGATC 7 cut(s) 323, 518, 1826, 1839, 2361, 2814, 2889
AcoI YGGCCR 1 cut(s) 1029
AcsI RAATTY 6 cut(s) 1448, 2023, 2310, 2470, 2994, 3294
AcuI CTGAAG 3 cut(s) 1028, 1845, 2132
AfaI GTAC 7 cut(s) 342, 537, 1000, 1078, 1779, 2227, 3344
AfiI CCNNNNNNNGG 8 cut(s) 1136, 1963, 2005, 2170, 2611, 2798, 2824, 3405
AflII CTTAAG 2 cut(s) 1895, 2438
AflIII ACRYGT 2 cut(s) 2426, 3478
AhdI GACNNNNNGTC 1 cut(s) 1933
AjiI CACGTC 2 cut(s) 2754, 2945
AjnI CCWGG 5 cut(s) 768, 1162, 1309, 2163, 2839
AjuI GAANNNNNNNTTGG 4 cut(s) 2403, 2435, 3444, 3476
Alw21I GWGCWC 6 cut(s) 276, 1275, 2586, 2652, 2893, 3163
Alw26I GTCTC 8 cut(s) 821, 1308, 1638, 1973, 2285, 2756, 2773, 3430
Alw44I GTGCAC 2 cut(s) 272, 2889
AlwI GGATC 7 cut(s) 323, 518, 1826, 1839, 2361, 2814, 2889
Ama87I CYCGRG 3 cut(s) 683, 1353, 2201
AoxI GGCC 8 cut(s) 180, 680, 766, 1029, 1159, 2107, 2837, 3321
ApaLI GTGCAC 2 cut(s) 272, 2889
ApeKI GCWGC 9 cut(s) 5, 449, 644, 927, 2079, 2454, 2499, 2713, 2748
ApoI RAATTY 6 cut(s) 1448, 2023, 2310, 2470, 2994, 3294
AspS9I GGNCC 4 cut(s) 181, 681, 766, 1160
AsuC2I CCSGG 3 cut(s) 82, 1734, 2985
AsuHPI GGTGA 9 cut(s) 83, 168, 305, 500, 1154, 1325, 3019, 3383, 3421
AsuII TTCGAA 1 cut(s) 918
AvaI CYCGRG 3 cut(s) 683, 1353, 2201
AxyI CCTNAGG 1 cut(s) 1962
BaeGI GKGCMC 4 cut(s) 276, 404, 599, 2893
BalI TGGCCA 1 cut(s) 1031
BamHI GGATCC 1 cut(s) 1831
BanII GRGCYC 4 cut(s) 1275, 2586, 2652, 3387
BarI GAAGNNNNNNTAC 2 cut(s) 3559, 3591
BauI CACGAG 2 cut(s) 1059, 2396
BbsI GAAGAC 3 cut(s) 1422, 1970, 2477
Bbv12I GWGCWC 6 cut(s) 276, 1275, 2586, 2652, 2893, 3163
BbvCI CCTCAGC 3 cut(s) 885, 2169, 2597
BbvI GCAGC 8 cut(s) 461, 656, 914, 2091, 2466, 2486, 2700, 2735
BceAI ACGGC 5 cut(s) 18, 337, 532, 1059, 2761
BciT130I CCWGG 5 cut(s) 770, 1164, 1311, 2165, 2841
BciVI GTATCC 1 cut(s) 3150
BcnI CCSGG 3 cut(s) 82, 1734, 2985
BcoDI GTCTC 8 cut(s) 821, 1308, 1638, 1973, 2285, 2756, 2773, 3430
BfaI CTAG 1 cut(s) 2759
BfrI CTTAAG 2 cut(s) 1895, 2438
BfuI GTATCC 1 cut(s) 3150
BglII AGATCT 2 cut(s) 2179, 3445
Bme1390I CCNGG 8 cut(s) 82, 770, 1164, 1311, 1734, 2165, 2841, 2985
BmeRI GACNNNNNGTC 1 cut(s) 1933
BmeT110I CYCGRG 3 cut(s) 683, 1353, 2201
BmgBI CACGTC 2 cut(s) 2754, 2945
BmgT120I GGNCC 4 cut(s) 181, 681, 766, 1160
BmiI GGNNCC 5 cut(s) 1833, 2175, 2603, 3384, 3492
BmrFI CCNGG 8 cut(s) 82, 770, 1164, 1311, 1734, 2165, 2841, 2985
BmrI ACTGGG 3 cut(s) 1429, 1933, 2014
BmsI GCATC 9 cut(s) 358, 553, 1555, 1573, 1662, 1866, 2269, 2313, 2728
BmuI ACTGGG 3 cut(s) 1429, 1933, 2014
BoxI GACNNNNGTC 1 cut(s) 3180
BpiI GAAGAC 3 cut(s) 1422, 1970, 2477
BplI GAGNNNNNCTC 6 cut(s) 1783, 1815, 1901, 1933, 2753, 2785
BpmI CTGGAG 2 cut(s) 176, 1158
Bpu10I CCTNAGC 6 cut(s) 885, 1761, 1816, 2169, 2597, 2606
Bpu14I TTCGAA 1 cut(s) 918
BpuEI CTTGAG 9 cut(s) 1289, 1785, 1955, 1968, 2108, 2531, 2566, 2698, 2755
BpuMI CCSGG 3 cut(s) 82, 1734, 2985
Bsa29I ATCGAT 2 cut(s) 1626, 2142
BsaBI GATNNNNATC 1 cut(s) 3038
BsaI GGTCTC 1 cut(s) 1973
BsaJI CCNNGG 8 cut(s) 1162, 1309, 1732, 1827, 2717, 2840, 3076, 3318
BsaWI WCCGGW 1 cut(s) 3357
Bsc4I CCNNNNNNNGG 8 cut(s) 1136, 1963, 2005, 2170, 2611, 2798, 2824, 3405
Bse118I RCCGGY 1 cut(s) 178
Bse1I ACTGG 8 cut(s) 159, 831, 1424, 1928, 2009, 2544, 2676, 2818
Bse21I CCTNAGG 1 cut(s) 1962
Bse3DI GCAATG 1 cut(s) 879
Bse8I GATNNNNATC 1 cut(s) 3038
BseBI CCWGG 5 cut(s) 770, 1164, 1311, 2165, 2841
BseCI ATCGAT 2 cut(s) 1626, 2142
BseDI CCNNGG 8 cut(s) 1162, 1309, 1732, 1827, 2717, 2840, 3076, 3318
BseGI GGATG 7 cut(s) 268, 835, 1771, 1827, 2014, 2743, 3032
BseJI GATNNNNATC 1 cut(s) 3038
BseLI CCNNNNNNNGG 8 cut(s) 1136, 1963, 2005, 2170, 2611, 2798, 2824, 3405
BseMI GCAATG 1 cut(s) 879
BseMII CTCAG 6 cut(s) 876, 1976, 2160, 2199, 2588, 2597
BseNI ACTGG 8 cut(s) 159, 831, 1424, 1928, 2009, 2544, 2676, 2818
BseRI GAGGAG 5 cut(s) 177, 401, 596, 2528, 3042
BseSI GKGCMC 4 cut(s) 276, 404, 599, 2893
BseXI GCAGC 8 cut(s) 461, 656, 914, 2091, 2466, 2486, 2700, 2735
BsgI GTGCAG 3 cut(s) 1985, 2734, 2772
Bsh1236I CGCG 1 cut(s) 3309
Bsh1285I CGRYCG 1 cut(s) 3358
BshFI GGCC 8 cut(s) 182, 682, 768, 1031, 1161, 2109, 2839, 3323
BshVI ATCGAT 2 cut(s) 1626, 2142
BsiEI CGRYCG 1 cut(s) 3358
BsiHKAI GWGCWC 6 cut(s) 276, 1275, 2586, 2652, 2893, 3163
BsiHKCI CYCGRG 3 cut(s) 683, 1353, 2201
BsiSI CCGG 5 cut(s) 82, 179, 1734, 2984, 3358
BsiWI CGTACG 1 cut(s) 1076
BslFI GGGAC 4 cut(s) 1069, 1940, 2980, 3560
BslI CCNNNNNNNGG 8 cut(s) 1136, 1963, 2005, 2170, 2611, 2798, 2824, 3405
BsmAI GTCTC 8 cut(s) 821, 1308, 1638, 1973, 2285, 2756, 2773, 3430
BsmBI CGTCTC 1 cut(s) 2285
BsmFI GGGAC 4 cut(s) 1069, 1940, 2980, 3560
BsmI GAATGC 3 cut(s) 1724, 1817, 3104
BsnI GGCC 8 cut(s) 182, 682, 768, 1031, 1161, 2109, 2839, 3323
Bso31I GGTCTC 1 cut(s) 1973
BsoBI CYCGRG 3 cut(s) 683, 1353, 2201
Bsp119I TTCGAA 1 cut(s) 918
Bsp1286I GDGCHC 9 cut(s) 276, 404, 599, 1275, 2586, 2652, 2893, 3163, 3387
Bsp1407I TGTACA 1 cut(s) 2225
Bsp19I CCATGG 2 cut(s) 1827, 2717
Bsp68I TCGCGA 1 cut(s) 3309
BspACI CCGC 5 cut(s) 9, 452, 647, 3193, 3363
BspANI GGCC 8 cut(s) 182, 682, 768, 1031, 1161, 2109, 2839, 3323
BspCNI CTCAG 6 cut(s) 877, 1975, 2161, 2198, 2589, 2598
BspDI ATCGAT 2 cut(s) 1626, 2142
BspFNI CGCG 1 cut(s) 3309
BspLI GGNNCC 5 cut(s) 1833, 2175, 2603, 3384, 3492
BspPI GGATC 7 cut(s) 323, 518, 1826, 1839, 2361, 2814, 2889
BspT104I TTCGAA 1 cut(s) 918
BspTI CTTAAG 2 cut(s) 1895, 2438
BspTNI GGTCTC 1 cut(s) 1973
BsrBI CCGCTC 2 cut(s) 3193, 3363
BsrDI GCAATG 1 cut(s) 879
BsrFI RCCGGY 1 cut(s) 178
BsrGI TGTACA 1 cut(s) 2225
BsrI ACTGG 8 cut(s) 159, 831, 1424, 1928, 2009, 2544, 2676, 2818
BssAI RCCGGY 1 cut(s) 178
BssECI CCNNGG 8 cut(s) 1162, 1309, 1732, 1827, 2717, 2840, 3076, 3318
BssSI CACGAG 2 cut(s) 1059, 2396
BssT1I CCWWGG 2 cut(s) 1827, 2717
Bst2BI CACGAG 2 cut(s) 1059, 2396
Bst2UI CCWGG 5 cut(s) 770, 1164, 1311, 2165, 2841
Bst4CI ACNGT 5 cut(s) 1666, 1905, 2767, 2926, 3403
Bst6I CTCTTC 1 cut(s) 913
BstAFI CTTAAG 2 cut(s) 1895, 2438
BstAUI TGTACA 1 cut(s) 2225
BstBI TTCGAA 1 cut(s) 918
BstC8I GCNNGC 4 cut(s) 423, 618, 925, 3583
BstDSI CCRYGG 2 cut(s) 1827, 2717
BstENI CCTNNNNNAGG 2 cut(s) 1961, 2168
BstF5I GGATG 7 cut(s) 268, 835, 1771, 1827, 2014, 2743, 3032
BstFNI CGCG 1 cut(s) 3309
BstMAI GTCTC 8 cut(s) 821, 1308, 1638, 1973, 2285, 2756, 2773, 3430
BstMCI CGRYCG 1 cut(s) 3358
BstMWI GCNNNNNNNGC 4 cut(s) 2071, 2473, 2647, 2719
BstNI CCWGG 5 cut(s) 770, 1164, 1311, 2165, 2841
BstNSI RCATGY 3 cut(s) 1539, 2430, 3482
BstPAI GACNNNNGTC 1 cut(s) 3180
BstSCI CCNGG 8 cut(s) 80, 768, 1162, 1309, 1732, 2163, 2839, 2983
BstSLI GKGCMC 4 cut(s) 276, 404, 599, 2893
BstUI CGCG 1 cut(s) 3309
BstV1I GCAGC 8 cut(s) 461, 656, 914, 2091, 2466, 2486, 2700, 2735
BstV2I GAAGAC 3 cut(s) 1422, 1970, 2477
BstX2I RGATCY 5 cut(s) 328, 523, 1831, 2179, 3445
BstXI CCANNNNNNTGG 1 cut(s) 2164
BstYI RGATCY 5 cut(s) 328, 523, 1831, 2179, 3445
Bsu15I ATCGAT 2 cut(s) 1626, 2142
Bsu36I CCTNAGG 1 cut(s) 1962
BsuI GTATCC 1 cut(s) 3150
BsuRI GGCC 8 cut(s) 182, 682, 768, 1031, 1161, 2109, 2839, 3323
BsuTUI ATCGAT 2 cut(s) 1626, 2142
BtgI CCRYGG 2 cut(s) 1827, 2717
BtgZI GCGATG 1 cut(s) 1516
BtrI CACGTC 2 cut(s) 2754, 2945
BtsCI GGATG 7 cut(s) 268, 835, 1771, 1827, 2014, 2743, 3032
BtsI GCAGTG 1 cut(s) 3568
BtsIMutI CAGTG 5 cut(s) 824, 2002, 2669, 3399, 3568
BtuMI TCGCGA 1 cut(s) 3309
Cac8I GCNNGC 4 cut(s) 423, 618, 925, 3583
Cfr10I RCCGGY 1 cut(s) 178
Cfr13I GGNCC 4 cut(s) 181, 681, 766, 1160
ClaI ATCGAT 2 cut(s) 1626, 2142
CseI GACGC 3 cut(s) 1901, 2921, 2928
Csp6I GTAC 7 cut(s) 341, 536, 999, 1077, 1778, 2226, 3343
CspCI CAANNNNNGTGG 2 cut(s) 1320, 1355
CviQI GTAC 7 cut(s) 341, 536, 999, 1077, 1778, 2226, 3343
DraI TTTAAA 1 cut(s) 762
DriI GACNNNNNGTC 1 cut(s) 1933
EaeI YGGCCR 1 cut(s) 1029
Eam1104I CTCTTC 1 cut(s) 913
Eam1105I GACNNNNNGTC 1 cut(s) 1933
EarI CTCTTC 1 cut(s) 913
Ecl136II GAGCTC 3 cut(s) 1273, 2584, 2650
Eco130I CCWWGG 2 cut(s) 1827, 2717
Eco147I AGGCCT 2 cut(s) 2109, 3323
Eco24I GRGCYC 4 cut(s) 1275, 2586, 2652, 3387
Eco31I GGTCTC 1 cut(s) 1973
Eco32I GATATC 1 cut(s) 28
Eco53kI GAGCTC 3 cut(s) 1273, 2584, 2650
Eco57I CTGAAG 3 cut(s) 1028, 1845, 2132
Eco81I CCTNAGG 1 cut(s) 1962
Eco88I CYCGRG 3 cut(s) 683, 1353, 2201
EcoICRI GAGCTC 3 cut(s) 1273, 2584, 2650
EcoNI CCTNNNNNAGG 2 cut(s) 1961, 2168
EcoO109I RGGNCCY 1 cut(s) 766
EcoRI GAATTC 2 cut(s) 2023, 2470
EcoRII CCWGG 5 cut(s) 768, 1162, 1309, 2163, 2839
EcoRV GATATC 1 cut(s) 28
EcoT14I CCWWGG 2 cut(s) 1827, 2717
EcoT22I ATGCAT 5 cut(s) 373, 568, 1677, 1724, 1881
EcoT38I GRGCYC 4 cut(s) 1275, 2586, 2652, 3387
ErhI CCWWGG 2 cut(s) 1827, 2717
Esp3I CGTCTC 1 cut(s) 2285
FalI AAGNNNNNCTT 2 cut(s) 1941, 1973
FaqI GGGAC 4 cut(s) 1069, 1940, 2980, 3560
FauNDI CATATG 1 cut(s) 2070
FokI GGATG 7 cut(s) 275, 842, 1778, 1834, 2021, 2750, 3039
FriOI GRGCYC 4 cut(s) 1275, 2586, 2652, 3387
FspBI CTAG 1 cut(s) 2759
GsuI CTGGAG 2 cut(s) 176, 1158
HaeIII GGCC 8 cut(s) 182, 682, 768, 1031, 1161, 2109, 2839, 3323
HapII CCGG 5 cut(s) 82, 179, 1734, 2984, 3358
HgaI GACGC 3 cut(s) 1901, 2921, 2928
HincII GTYRAC 1 cut(s) 1945
HindII GTYRAC 1 cut(s) 1945
HindIII AAGCTT 6 cut(s) 209, 921, 2270, 2402, 3044, 3583
HpaII CCGG 5 cut(s) 82, 179, 1734, 2984, 3358
HphI GGTGA 9 cut(s) 83, 168, 305, 500, 1154, 1325, 3019, 3383, 3421
Hpy166II GTNNAC 7 cut(s) 274, 296, 491, 1001, 1755, 1945, 2891
Hpy8I GTNNAC 7 cut(s) 274, 296, 491, 1001, 1755, 1945, 2891
Hpy99I CGWCG 3 cut(s) 39, 2949, 2952
HpyCH4III ACNGT 5 cut(s) 1666, 1905, 2767, 2926, 3403
HpyCH4IV ACGT 4 cut(s) 118, 2482, 2753, 2944
HpyF10VI GCNNNNNNNGC 4 cut(s) 2071, 2473, 2647, 2719
HpySE526I ACGT 4 cut(s) 118, 2482, 2753, 2944
Lsp1109I GCAGC 8 cut(s) 461, 656, 914, 2091, 2466, 2486, 2700, 2735
LweI GCATC 9 cut(s) 358, 553, 1555, 1573, 1662, 1866, 2269, 2313, 2728
MaeI CTAG 1 cut(s) 2759
MaeII ACGT 4 cut(s) 118, 2482, 2753, 2944
MbiI CCGCTC 2 cut(s) 3193, 3363
MfeI CAATTG 2 cut(s) 1704, 1806
MflI RGATCY 5 cut(s) 328, 523, 1831, 2179, 3445
MhlI GDGCHC 9 cut(s) 276, 404, 599, 1275, 2586, 2652, 2893, 3163, 3387
MlsI TGGCCA 1 cut(s) 1031
MluNI TGGCCA 1 cut(s) 1031
MlyI GAGTC 9 cut(s) 695, 897, 1922, 2200, 2569, 2635, 2701, 3432, 3560
MmeI TCCRAC 4 cut(s) 754, 1413, 1685, 2715
Mox20I TGGCCA 1 cut(s) 1031
Mph1103I ATGCAT 5 cut(s) 373, 568, 1677, 1724, 1881
MscI TGGCCA 1 cut(s) 1031
MseI TTAA 8 cut(s) 699, 761, 1242, 1374, 1725, 1896, 2132, 2439
MslI CAYNNNNRTG 5 cut(s) 105, 1506, 1628, 2007, 2289
Msp20I TGGCCA 1 cut(s) 1031
MspA1I CMGCKG 2 cut(s) 452, 647
MspCI CTTAAG 2 cut(s) 1895, 2438
MspI CCGG 5 cut(s) 82, 179, 1734, 2984, 3358
MspR9I CCNGG 8 cut(s) 82, 770, 1164, 1311, 1734, 2165, 2841, 2985
MunI CAATTG 2 cut(s) 1704, 1806
Mva1269I GAATGC 3 cut(s) 1724, 1817, 3104
MvaI CCWGG 5 cut(s) 770, 1164, 1311, 2165, 2841
MvnI CGCG 1 cut(s) 3309
MwoI GCNNNNNNNGC 4 cut(s) 2071, 2473, 2647, 2719
NciI CCSGG 3 cut(s) 82, 1734, 2985
NcoI CCATGG 2 cut(s) 1827, 2717
NdeI CATATG 1 cut(s) 2070
NlaIV GGNNCC 5 cut(s) 1833, 2175, 2603, 3384, 3492
NmeAIII GCCGAG 2 cut(s) 2506, 2572
NmuCI GTSAC 6 cut(s) 1913, 2393, 2667, 2754, 2940, 3182
NruI TCGCGA 1 cut(s) 3309
NsiI ATGCAT 5 cut(s) 373, 568, 1677, 1724, 1881
NspI RCATGY 3 cut(s) 1539, 2430, 3482
NspV TTCGAA 1 cut(s) 918
PaeR7I CTCGAG 2 cut(s) 1353, 2201
PceI AGGCCT 2 cut(s) 2109, 3323
PciI ACATGT 2 cut(s) 2426, 3478
PcsI WCGNNNNNNNCGW 1 cut(s) 3090
PctI GAATGC 3 cut(s) 1724, 1817, 3104
Pfl23II CGTACG 1 cut(s) 1076
PfoI TCCNGGA 1 cut(s) 2983
PleI GAGTC 9 cut(s) 694, 897, 1922, 2199, 2568, 2634, 2700, 3431, 3559
PpsI GAGTC 9 cut(s) 694, 897, 1922, 2199, 2568, 2634, 2700, 3431, 3559
PscI ACATGT 2 cut(s) 2426, 3478
PshAI GACNNNNGTC 1 cut(s) 3180
PsiI TTATAA 1 cut(s) 2864
Psp124BI GAGCTC 3 cut(s) 1275, 2586, 2652
Psp6I CCWGG 5 cut(s) 768, 1162, 1309, 2163, 2839
PspGI CCWGG 5 cut(s) 768, 1162, 1309, 2163, 2839
PspLI CGTACG 1 cut(s) 1076
PspN4I GGNNCC 5 cut(s) 1833, 2175, 2603, 3384, 3492
PspPI GGNCC 4 cut(s) 181, 681, 766, 1160
PspXI VCTCGAGB 1 cut(s) 1353
PsuI RGATCY 5 cut(s) 328, 523, 1831, 2179, 3445
RruI TCGCGA 1 cut(s) 3309
RsaI GTAC 7 cut(s) 342, 537, 1000, 1078, 1779, 2227, 3344
RsaNI GTAC 7 cut(s) 341, 536, 999, 1077, 1778, 2226, 3343
RseI CAYNNNNRTG 5 cut(s) 105, 1506, 1628, 2007, 2289
SacI GAGCTC 3 cut(s) 1275, 2586, 2652
SaqAI TTAA 8 cut(s) 699, 761, 1242, 1374, 1725, 1896, 2132, 2439
Sau96I GGNCC 4 cut(s) 181, 681, 766, 1160
SchI GAGTC 9 cut(s) 695, 897, 1922, 2200, 2569, 2635, 2701, 3432, 3560
ScrFI CCNGG 8 cut(s) 82, 770, 1164, 1311, 1734, 2165, 2841, 2985
SduI GDGCHC 9 cut(s) 276, 404, 599, 1275, 2586, 2652, 2893, 3163, 3387
SfaNI GCATC 9 cut(s) 358, 553, 1555, 1573, 1662, 1866, 2269, 2313, 2728
Sfr274I CTCGAG 2 cut(s) 1353, 2201
SfuI TTCGAA 1 cut(s) 918
SlaI CTCGAG 2 cut(s) 1353, 2201
SmiMI CAYNNNNRTG 5 cut(s) 105, 1506, 1628, 2007, 2289
SseBI AGGCCT 2 cut(s) 2109, 3323
SsiI CCGC 5 cut(s) 9, 452, 647, 3193, 3363
SspI AATATT 1 cut(s) 2446
SspMI CTAG 1 cut(s) 2759
SstI GAGCTC 3 cut(s) 1275, 2586, 2652
StuI AGGCCT 2 cut(s) 2109, 3323
StyD4I CCNGG 8 cut(s) 80, 768, 1162, 1309, 1732, 2163, 2839, 2983
StyI CCWWGG 2 cut(s) 1827, 2717
TaaI ACNGT 5 cut(s) 1666, 1905, 2767, 2926, 3403
TaiI ACGT 4 cut(s) 121, 2485, 2756, 2947
TatI WGTACW 2 cut(s) 1777, 2225
TauI GCSGC 2 cut(s) 11, 3366
Tru1I TTAA 8 cut(s) 699, 761, 1242, 1374, 1725, 1896, 2132, 2439
Tru9I TTAA 8 cut(s) 699, 761, 1242, 1374, 1725, 1896, 2132, 2439
TscAI CASTG 5 cut(s) 831, 2009, 2676, 3406, 3568
TseFI GTSAC 6 cut(s) 1913, 2393, 2667, 2754, 2940, 3182
TseI GCWGC 9 cut(s) 5, 449, 644, 927, 2079, 2454, 2499, 2713, 2748
Tsp45I GTSAC 6 cut(s) 1913, 2393, 2667, 2754, 2940, 3182
TspGWI ACGGA 2 cut(s) 1378, 2908
TspRI CASTG 5 cut(s) 831, 2009, 2676, 3406, 3568
Vha464I CTTAAG 2 cut(s) 1895, 2438
VneI GTGCAC 2 cut(s) 272, 2889
XagI CCTNNNNNAGG 2 cut(s) 1961, 2168
XapI RAATTY 6 cut(s) 1448, 2023, 2310, 2470, 2994, 3294
XceI RCATGY 3 cut(s) 1539, 2430, 3482
XhoI CTCGAG 2 cut(s) 1353, 2201
XspI CTAG 1 cut(s) 2759
Zsp2I ATGCAT 5 cut(s) 373, 568, 1677, 1724, 1881
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.