Rmu_sc0002833.1_g000022

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002833.1
Physical Location & Seq
Forward (+)
93596 .. 97545
3950 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002833.1_g000022.1.cds

Sequence Viewer

Length: 3630 bp
atggccgcttcttcttcttgctctgatagcatccctcaggagaagcatgatgtttttcttagtttcagaggcgaggacacccggaataatttcaccagccatctttatgaggctttatgtcagaaaaaaatccaaacttacatagattacaaactggagagaggggatgaaatctcacctgcccttttcaaagcaattgaagaatcgaagctttcggttatcattttctccaaaaactatgcttcttctgcatggtgcttggatgaacttgtgcacatactcaaatgtagagatctctataaacagtttgttatacccatcttctacggggtagatccatcagccgtacgcaaacaatctgggagttatgcagagaaacgtttcaagggcccaatggacaaggtgctcaggtggagagaggctttgacaacagcagccaatatatctgggtttgattcccaaacaattaggcgggagtctgatttagttaagattgtggtcaatgacatcttggcgaagttgaattgcaaattgcaaatcgcatggggtttagagggcctggttggaatggaaaaacacattcgacaagttgaatttttattatgtctcaactcactggatgtccagattgtaggtatttggggtatgggtggtatcggtaagaccaccattgctgaggttgtatttgctcatctctcttctcaattcgaagcttgctgcttcattgcaaatgttagggaatcggaggcgaaacatggactaaatgatttgtggaatcagattcttcgtaaactactgaaggatgaaaatctatgtatggccacttcatctcttgtctcaacttttgcaagagagaggctttgcagtacaaaggccctcattgttcttgatgatgtgagtgagttttcccaattagaacttttagctagaggtgattgcaatctgtttggccctggaagtagaatccttgtaacaaccagagataaacgcatatttaggaatagtgttgataaagataagatatatgaggttaaggaattagcctatgatgaagctcttgagctctttcatttgatagcttttagaaataagtctcccccgggtgattatacaacttttgcaaaagaggtggtagattatgctggaggcaatccattggctcttacaatcttgggctccgtaatattctgtcattgcaagagcaaagaagactgggaaggtgaattagtgaaattgaaaaaatttcctaacaaaagaatccagaatgtattgagattcagttatgatggattagaagaaaatgagagggagatatttctcgatatcgcctgttatcacaaagggaagcatattgatgaggcaaaaagaattttagatgcctgtggtttttgtgccaatgcaggagttaaaattctcgttgatatgtctctcatatccgtaggtgaagaatattcaacacttaagatgcatgatttgatacaagaaatgggtcgggaaattgttcgtggtcaatgtgttaaaaatcctgaaaaacgcagtagattgtggcttgcaaatgatgttcgtcgtgtactgacaaataatacgggtactgaagtcattgagtgcatggccatgaatatggatctcattaaatctcatttatacgtgaatgttgaatccttcgaaaagatgcatgagctaagattactagatctatactcatactcggacacccggggtgtcaacaaattgcaccttcctacaggtttcgagtttctccctgaggcccttaaatatctgaggtggcatttctatcctttgacatctctgccatcgaggttttctccagaaaaccttgtcgagcttcatatgcaccgcagccgacttgagcaactttggaataaaggcgtgcagatcaatcttgagagcttaaaacgtatcgatcttagattctccgagcacctggctgatgtttcagctctgattgagagtccaaatctcgagagcattgaccttgggggttgtaaaagtttggttcaacttccttcatcgtttcagaatcttgccaagcttacttctcttagtctgaatggttgctccaatctcaaaattctcccagagatgccaggcaatctggaagtcttagtgttgcaagggactgcaatagaagaattgccttcatcaatttggtctctcgagaagcttcatcaatttggtcttcaattttgtgaagagcttaagaatcttccaagcagcacttgtaggttgaattcgctccaaattcttgatgtatgtggctgccgctctcttgagtctatgcctgtcgagctaccttctgggctgaaggaactgaagttgatcaattgcaagagtcttgggtctttgcctgtcgagctaccttctgggctgaagacactgaaattgagatattgcaagagtctttggtcttggcctgtcgagctaccttctgggctgaagacactggaatcgagaaattgcaagagtcttgggtctttgcctgtcgagctaccttctgggctggagtacctggacttgagcgattgtgagagtcttgggtctttgcctgtcgagctaccttctgggctgaagacactgaaattgagatattgcaagagtctttggtcttggcctgtcgagctaccttctgggctgaagacactggaattgagaaattgcaagagtcttcgatctttaccgaacctgccatggcttctagcatcgtttaatgcagaaggctgcacgtcactagagacagtctcaagtccgagggggactgcacccatacaaggtagggatcaatatatcaacccatacagtttcgagcaactattatttatgaattgcgtgaaattggatcagagtgcacggagcaacataatggctgatgcacagcttagagttatgcgaattgcaactgcatcacgtctcctcaaggaaagccgtacgattaatattgtttgtccgggaaatgaaattccaaagtggatgacgtatcaaagtgagggatgttcgataaatattaagcttcctcctcattggtttcgtcaaggcttcctcggttacgctctatgcattgtggttgcattcaacaactatacgccaccctatattaacaattattccgtatttagttgtgaaacccatcacaaaactaacaatagtcacgaagtttatcggcgatccctcggtagaagactaccagctattctcatcaattcagatcatgtgttcgtgtggtatttctgccctgaatttgttcgatcagaaagtgcaatcaatcgcgaggattgggtaaaagcatccgaggcctcttttgacttcaagttgtatgaaaaatttgttcagatcccaaaagatagacatcatttctttgacccctccactgtgagggtgaaaaggtgtggagtctccttgttgtatgcccaagagattgaaaaattacttggaggcattgatgaagatgaagttatggaaccaaaacaagcagtagaagaagatatcaccatcaaaactaagagacgacgggacgagtctgaactcagtggaagtggaactgcaagcttcaaagaagaatataacgaccaactacctccccatagtagtaaaaggaaaatcaacatcatgtga

Protein Analysis

1209

Amino Acids

137.31

Weight (kDa)

6.96

Isoelectric Point (pI)

54.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000020)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g26600 FvH4_2g27070 FvH4_2g27070 FvH4_2g27070 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27370 FvH4_2g27701 FvH4_2g27720 FvH4_3g05740 FvH4_3g05740 FvH4_3g05740 FvH4_3g05740 FvH4_3g15720 FvH4_5g35770 FvH4_5g35770 FvH4_5g35770 FvH4_5g35770 FvH4_5g35770 FvH4_6g34390 FvH4_6g34410 FvH4_6g34410
malus_domestica MD02G1278900.v1.1 MD03G1127300.v1.1 MD04G1027100.v1.1 MD04G1035000.v1.1 MD04G1035200.v1.1 MD04G1035600.v1.1 MD04G1036000.v1.1 MD04G1036100.v1.1 MD04G1036400.v1.1 MD05G1125400.v1.1 MD05G1125600.v1.1 MD05G1125700.v1.1 MD05G1126000.v1.1 MD05G1131900.v1.1 MD05G1132400.v1.1 MD05G1132600.v1.1 MD05G1132800.v1.1 MD05G1135700.v1.1 MD05G1135800.v1.1 MD05G1136700.v1.1 MD05G1137400.v1.1 MD05G1137900.v1.1 MD05G1138300.v1.1 MD05G1138400.v1.1 MD05G1138500.v1.1 MD05G1141700.v1.1 MD05G1142600.v1.1 MD05G1143300.v1.1 MD05G1145200.v1.1 MD05G1146500.v1.1 MD05G1146600.v1.1 MD05G1147100.v1.1 MD05G1147500.v1.1 MD05G1147600.v1.1 MD05G1148300.v1.1 MD05G1148600.v1.1 MD05G1149400.v1.1 MD05G1149500.v1.1 MD05G1150100.v1.1 MD05G1150200.v1.1 MD05G1150900.v1.1 MD05G1151200.v1.1 MD08G1168700.v1.1 MD10G1128400.v1.1 MD10G1128500.v1.1 MD10G1128600.v1.1 MD10G1134800.v1.1 MD10G1135300.v1.1 MD10G1135800.v1.1 MD10G1135900.v1.1 MD10G1136100.v1.1 MD10G1136200.v1.1 MD10G1136400.v1.1 MD10G1136500.v1.1 MD10G1136600.v1.1 MD10G1137100.v1.1 MD10G1137400.v1.1 MD10G1137500.v1.1 MD10G1137700.v1.1 MD10G1140900.v1.1 MD10G1141100.v1.1 MD10G1141400.v1.1 MD12G1073200.v1.1 MD12G1074900.v1.1 MD16G1140700.v1.1
prunus_persica Prupe.1G160400_v2.0.a1 Prupe.1G160500_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G060400_v2.0.a1 Prupe.2G083200_v2.0.a1 Prupe.6G152300_v2.0.a1 Prupe.8G037000_v2.0.a1 Prupe.8G117300_v2.0.a1 Prupe.8G117700_v2.0.a1 Prupe.8G118900_v2.0.a1 Prupe.8G173600_v2.0.a1 Prupe.8G173700_v2.0.a1 Prupe.8G176400_v2.0.a1 Prupe.8G179400_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G179500_v2.0.a1 Prupe.8G237200_v2.0.a1 Prupe.I001800_v2.0.a1 Prupe.I002000_v2.0.a1 Prupe.I002100_v2.0.a1 Prupe.I002200_v2.0.a1 Prupe.I002300_v2.0.a1 Prupe.I002300_v2.0.a1 Prupe.I002300_v2.0.a1
pyrus_communis pycom02g10490 pycom03g08410 pycom04g02350 pycom04g02370 pycom04g02890 pycom04g02920 pycom04g02930 pycom05g09430 pycom05g11970 pycom05g11980 pycom05g12000 pycom05g12010 pycom05g12040 pycom05g12080 pycom05g12100 pycom05g12110 pycom05g12160 pycom05g12910 pycom05g12920 pycom05g12940 pycom05g13220 pycom05g13230 pycom05g13260 pycom05g13300 pycom05g13320 pycom05g13330 pycom05g13350 pycom05g13680 pycom05g13710 pycom05g13720 pycom05g13730 pycom05g14120 pycom05g14130 pycom05g14160 pycom05g14210 pycom05g14250 pycom05g14280 pycom05g14290 pycom05g14340 pycom05g14390 pycom05g14430 pycom05g14460 pycom05g14530 pycom05g14560 pycom05g14570 pycom05g14580 pycom10g11010 pycom10g11020 pycom10g11030 pycom10g11250 pycom10g11640 pycom10g11670 pycom10g11680 pycom10g11720 pycom10g11730 pycom10g11950 pycom10g11960 pycom10g12000 pycom10g12050 pycom10g12070 pycom10g12310
rosa_chinensis RchiOBHm_Chr1g0314371 RchiOBHm_Chr1g0314461 RchiOBHm_Chr1g0314491 RchiOBHm_Chr1g0314661 RchiOBHm_Chr1g0314671 RchiOBHm_Chr1g0314701 RchiOBHm_Chr1g0314711 RchiOBHm_Chr1g0314741 RchiOBHm_Chr1g0327611 RchiOBHm_Chr1g0333931 RchiOBHm_Chr1g0334091 RchiOBHm_Chr1g0334101 RchiOBHm_Chr2g0144731 RchiOBHm_Chr2g0144751 RchiOBHm_Chr3g0451471 RchiOBHm_Chr3g0451481 RchiOBHm_Chr3g0451521 RchiOBHm_Chr3g0451541 RchiOBHm_Chr3g0451581 RchiOBHm_Chr3g0451641 RchiOBHm_Chr3g0451661 RchiOBHm_Chr3g0451671 RchiOBHm_Chr3g0484861 RchiOBHm_Chr5g0013861 RchiOBHm_Chr5g0013871 RchiOBHm_Chr5g0013881 RchiOBHm_Chr5g0013921 RchiOBHm_Chr5g0013931 RchiOBHm_Chr5g0026001 RchiOBHm_Chr5g0026101 RchiOBHm_Chr5g0026421 RchiOBHm_Chr5g0066271 RchiOBHm_Chr6g0287411 RchiOBHm_Chr6g0287421 RchiOBHm_Chr6g0287561 RchiOBHm_Chr6g0287581 RchiOBHm_Chr6g0287591 RchiOBHm_Chr6g0296221 RchiOBHm_Chr7g0237431
rosa_laevigata RLG00000001003 RLG00000011679 RLG00000011716 RLG00000012483 RLG00000012484 RLG00000013019 RLG00000015060 RLG00000020104 RLG00000020105 RLG00000020106 RLG00000020107 RLG00000020108 RLG00000020109 RLG00000023202 RLG00000024217 RLG00000025656 RLG00000025657 RLG00000026224 RLG00000029504 RLG00000029507 RLG00000029508 RLG00000029509 RLG00000029980 RLG00000030042 RLG00000032050 RLG00000032051 RLG00000032052 RLG00000032891 RLG00000032896 RLG00000032900 RLG00000032901 RLG00000032930 RLG00000032931 RLG00000035381 RLG00000035383 RLG00000035847
rosa_multiflora Rmu_co7983036.1_g000001 Rmu_co8026080.1_g000001 Rmu_co8242645.1_g000001 Rmu_co8396077.1_g000001 Rmu_co8406137.1_g000001 Rmu_co8420673.1_g000001 Rmu_co8458221.1_g000001 Rmu_sc0000026.1_g000007 Rmu_sc0000795.1_g000054 Rmu_sc0000997.1_g000011 Rmu_sc0001689.1_g000014 Rmu_sc0001802.1_g000009 Rmu_sc0002354.1_g000053 Rmu_sc0002354.1_g000055 Rmu_sc0002806.1_g000016 Rmu_sc0002833.1_g000022 Rmu_sc0002843.1_g000009 Rmu_sc0002923.1_g000021 Rmu_sc0003020.1_g000017 Rmu_sc0003598.1_g000012 Rmu_sc0003598.1_g000013 Rmu_sc0003598.1_g000014 Rmu_sc0003598.1_g000015 Rmu_sc0003690.1_g000001 Rmu_sc0004708.1_g000014 Rmu_sc0004924.1_g000009 Rmu_sc0004924.1_g000018 Rmu_sc0004924.1_g000022 Rmu_sc0004924.1_g000026 Rmu_sc0004924.1_g000032 Rmu_sc0004924.1_g000033 Rmu_sc0004924.1_g000037 Rmu_sc0004924.1_g000039 Rmu_sc0004974.1_g000006 Rmu_sc0005581.1_g000001 Rmu_sc0005581.1_g000010 Rmu_sc0005803.1_g000021 Rmu_sc0006653.1_g000009 Rmu_sc0007029.1_g000008 Rmu_sc0009360.1_g000007 Rmu_sc0009360.1_g000012 Rmu_sc0009360.1_g000013 Rmu_sc0009360.1_g000015 Rmu_sc0009360.1_g000021 Rmu_sc0009360.1_g000033 Rmu_sc0009360.1_g000048 Rmu_sc0009360.1_g000049 Rmu_sc0009360.1_g000051 Rmu_sc0011096.1_g000005 Rmu_sc0016584.1_g000002 Rmu_sc0020815.1_g000001 Rmu_sc0020815.1_g000002 Rmu_sc0025510.1_g000001 Rmu_sc0026263.1_g000003 Rmu_sc0029456.1_g000001 Rmu_sc0029457.1_g000001 Rmu_sc0029568.1_g000001 Rmu_sc0032214.1_g000001 Rmu_sc0041321.1_g000001 Rmu_sc0042928.1_g000001 Rmu_ssc0000042.1_g000010 Rmu_ssc0000042.1_g000019 Rmu_ssc0000042.1_g000020 Rmu_ssc0000126.1_g000058
rosa_roxburghii Rroxscaffold_164G00436360 Rroxscaffold_164G00436400 Rroxscaffold_164G00436430 Rroxscaffold_164G00436440 Rroxscaffold_164G00436470 Rroxscaffold_1G00052970 Rroxscaffold_1G00062790 Rroxscaffold_1G00062820 Rroxscaffold_2G00100990 Rroxscaffold_2G00101010 Rroxscaffold_3G00224210 Rroxscaffold_4G00297610 Rroxscaffold_4G00317070 Rroxscaffold_4G00317100 Rroxscaffold_4G00317110 Rroxscaffold_4G00317120 Rroxscaffold_4G00322520 Rroxscaffold_4G00322530 Rroxscaffold_4G00323280 Rroxscaffold_4G00331920 Rroxscaffold_6G00410350 Rroxscaffold_6G00428880 Rroxscaffold_6G00428910 Rroxscaffold_6G00428930 Rroxscaffold_7G00171360 Rroxscaffold_7G00171730 Rroxscaffold_7G00178330 Rroxscaffold_7G00178730 Rroxscaffold_7G00180960 Rroxscaffold_7G00181370
rosa_rugosa Rorug01G0001400 Rorug01G0001500 Rorug01G0001600 Rorug01G0001700 Rorug01G0068600 Rorug01G0068700 Rorug02G0389400 Rorug02G0389500 Rorug02G0634000 Rorug02G0634300 Rorug02G0634600 Rorug02G0634800 Rorug02G0634900 Rorug02G0634900 Rorug02G0635000 Rorug02G0635100 Rorug02G0635200 Rorug02G0635300 Rorug02G0635400 Rorug03G0213900 Rorug05G0012800 Rorug05G0012900 Rorug05G0013100 Rorug05G0013300 Rorug05G0090300 Rorug05G0090400 Rorug05G0092900 Rorug05G0093000 Rorug05G0093100 Rorug06G0189200 Rorug06G0189200 Rorug06G0189300 Rorug06G0189400 Rorug06G0259500 Rorug07G0303200 Rorug07G0303300.1
rosa_samantha Rh1AG010600 Rh1AG010900 Rh1AG011800 Rh1AG012100 Rh1AG012500 Rh1AG081000 Rh1AG085900 Rh1AG135300 Rh1AG135400 Rh1AG135500 Rh1AG135700 Rh1AG135800 Rh1AG136400 Rh1BG003400 Rh1BG003700 Rh1BG068500 Rh1BG103400 Rh1BG103500 Rh1BG103600 Rh1CG128600 Rh1CG128800 Rh1DG005800 Rh1DG090100 Rh1DG140800 Rh1DG140900 Rh1DG141100 Rh1DG141200 Rh1DG141500 Rh2AG441200 Rh2BG451500 Rh2BG451800 Rh2BG451900 Rh2CG428500 Rh2DG461500 Rh3AG037000 Rh3AG037100 Rh3AG037200 Rh3BG037600 Rh3BG037700 Rh3BG037800 Rh3BG038100 Rh3BG299500 Rh3BG299800 Rh3BG299900 Rh3CG036200 Rh3CG036400 Rh3CG036500 Rh3CG036800 Rh3CG297200 Rh3DG037100 Rh3DG037200 Rh3DG037400 Rh3DG293200 Rh5BG103800 Rh5BG104100 Rh5BG104200 Rh5BG180100 Rh5BG180200 Rh5BG183000 Rh5BG451600 Rh5CG115600 Rh5CG115700 Rh5CG115900 Rh5CG116100 Rh5CG198800 Rh5CG199300 Rh5CG202400 Rh5DG102100 Rh5DG102200 Rh5DG102300 Rh5DG102600 Rh5DG102800 Rh5DG181100 Rh5DG181300 Rh5DG181800 Rh5DG184900 Rh5DG185100 Rh6AG256000 Rh6AG299200 Rh6AG299300 Rh6AG300400 Rh6AG371800 Rh6BG383300 Rh6CG303400 Rh6CG314400 Rh6CG385000 Rh6DG297800 Rh6DG372300 Rh7BG046900 Rh7BG312300 Rh7BG312500 Rh7BG430400
rosa_wichuraiana Rw0G009620 Rw0G015730 Rw1G000490 Rw1G006410 Rw1G006700 Rw1G011270 Rw1G011280 Rw1G011310 Rw2G036080 Rw3G002740 Rw3G002750 Rw3G002760 Rw3G002770 Rw3G023580 Rw5G009360 Rw5G009370 Rw5G009380 Rw5G009390 Rw5G009400 Rw5G016550 Rw5G016890 Rw5G016910 Rw5G040760 Rw6G022190 Rw6G025910 Rw6G032400 Rw6G032690 Rw6G032790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 187
Acc36I ACCTGC 2 cut(s) 187, 2712
AccBSI CCGCTC 1 cut(s) 2286
AccII CGCG 1 cut(s) 3285
AciI CCGC 4 cut(s) 6, 472, 1858, 2284
AclI AACGTT 1 cut(s) 379
AclWI GGATC 6 cut(s) 329, 1632, 2805, 2865, 3177, 3343
AcoI YGGCCR 3 cut(s) 3, 819, 1611
AcuI CTGAAG 8 cut(s) 818, 1614, 2345, 2354, 2411, 2477, 2609, 2675
AfaI GTAC 6 cut(s) 348, 868, 1572, 1591, 2528, 2947
AfiI CCNNNNNNNGG 2 cut(s) 2789, 3390
AflII CTTAAG 2 cut(s) 1460, 2219
AjiI CACGTC 2 cut(s) 2745, 2927
AjnI CCWGG 5 cut(s) 558, 952, 1944, 2107, 2529
AjuI GAANNNNNNNTTGG 2 cut(s) 3429, 3461
Alw21I GWGCWC 5 cut(s) 276, 408, 1065, 1944, 2869
Alw44I GTGCAC 2 cut(s) 272, 2865
AlwI GGATC 6 cut(s) 329, 1632, 2805, 2865, 3177, 3343
Ama87I CYCGRG 4 cut(s) 1099, 1716, 1982, 2177
ApaI GGGCCC 1 cut(s) 392
ApaLI GTGCAC 2 cut(s) 272, 2865
ApeKI GCWGC 6 cut(s) 434, 717, 1860, 2235, 2280, 2739
AseI ATTAAT 1 cut(s) 2952
Asp700I GAANNNNTTC 4 cut(s) 89, 380, 1500, 3258
AspS9I GGNCC 6 cut(s) 388, 389, 556, 874, 950, 1768
AsuC2I CCSGG 6 cut(s) 82, 1100, 1101, 1717, 1718, 2967
AsuHPI GGTGA 8 cut(s) 85, 168, 944, 1115, 1232, 1454, 3406, 3496
AsuII TTCGAA 2 cut(s) 708, 1665
AvaI CYCGRG 4 cut(s) 1099, 1716, 1982, 2177
AxyI CCTNAGG 2 cut(s) 36, 1764
BaeGI GKGCMC 3 cut(s) 276, 392, 2869
BaeI ACNNNNGTAYC 2 cut(s) 1581, 1614
BalI TGGCCA 2 cut(s) 821, 1613
BanII GRGCYC 3 cut(s) 392, 1065, 1178
BarI GAAGNNNNNNTAC 2 cut(s) 808, 840
BbsI GAAGAC 8 cut(s) 1215, 2192, 2399, 2465, 2597, 2663, 2678, 3202
Bbv12I GWGCWC 5 cut(s) 276, 408, 1065, 1944, 2869
BbvCI CCTCAGC 1 cut(s) 675
BbvI GCAGC 6 cut(s) 446, 704, 1872, 2247, 2267, 2726
BccI CCATC 7 cut(s) 108, 326, 346, 1280, 1822, 3153, 3515
BceAI ACGGC 2 cut(s) 329, 2928
BciT130I CCWGG 5 cut(s) 560, 954, 1946, 2109, 2531
BclI TGATCA 1 cut(s) 2340
BcnI CCSGG 6 cut(s) 82, 1100, 1101, 1717, 1718, 2967
BfaI CTAG 4 cut(s) 927, 1691, 2717, 2750
BfmI CTRYAG 1 cut(s) 1743
BfrI CTTAAG 2 cut(s) 1460, 2219
BfuAI ACCTGC 2 cut(s) 187, 2712
BglII AGATCT 2 cut(s) 292, 1693
BisI GCNGC 8 cut(s) 6, 435, 718, 1861, 2236, 2281, 2284, 2740
BlsI GCNGC 8 cut(s) 7, 436, 719, 1862, 2237, 2282, 2285, 2741
BmeT110I CYCGRG 4 cut(s) 1099, 1716, 1982, 2177
BmgBI CACGTC 2 cut(s) 2745, 2927
BmgT120I GGNCC 6 cut(s) 388, 389, 556, 874, 950, 1768
BmiI GGNNCC 3 cut(s) 390, 1177, 3477
BmrI ACTGGG 1 cut(s) 1222
BmsI GCATC 9 cut(s) 39, 1366, 1455, 1662, 2094, 2729, 2878, 2930, 3311
BmuI ACTGGG 1 cut(s) 1222
BpiI GAAGAC 8 cut(s) 1215, 2192, 2399, 2465, 2597, 2663, 2678, 3202
BplI GAGNNNNNCTC 4 cut(s) 1810, 1842, 2744, 2776
BpmI CTGGAG 4 cut(s) 176, 1164, 1812, 2543
Bpu10I CCTNAGC 2 cut(s) 407, 675
Bpu14I TTCGAA 2 cut(s) 708, 1665
BpuEI CTTGAG 7 cut(s) 1079, 1889, 1925, 2312, 2557, 2746, 2918
BpuMI CCSGG 6 cut(s) 82, 1100, 1101, 1717, 1718, 2967
Bsa29I ATCGAT 1 cut(s) 1923
BsaAI YACGTR 1 cut(s) 1648
BsaBI GATNNNNATC 3 cut(s) 807, 939, 3363
BsaI GGTCTC 1 cut(s) 2178
Bsc4I CCNNNNNNNGG 2 cut(s) 2789, 3390
Bse1I ACTGG 5 cut(s) 159, 621, 1217, 2469, 2667
Bse21I CCTNAGG 2 cut(s) 36, 1764
Bse3DI GCAATG 3 cut(s) 669, 723, 1192
Bse8I GATNNNNATC 3 cut(s) 807, 939, 3363
BseBI CCWGG 5 cut(s) 560, 954, 1946, 2109, 2531
BseCI ATCGAT 1 cut(s) 1923
BseGI GGATG 8 cut(s) 30, 172, 268, 625, 808, 2994, 3014, 3302
BseJI GATNNNNATC 3 cut(s) 807, 939, 3363
BseLI CCNNNNNNNGG 2 cut(s) 2789, 3390
BseMI GCAATG 3 cut(s) 669, 723, 1192
BseMII CTCAG 6 cut(s) 50, 421, 666, 1755, 1772, 3556
BseNI ACTGG 5 cut(s) 159, 621, 1217, 2469, 2667
BseRI GAGGAG 2 cut(s) 2921, 3024
BseSI GKGCMC 3 cut(s) 276, 392, 2869
BseXI GCAGC 6 cut(s) 446, 704, 1872, 2247, 2267, 2726
BsgI GTGCAG 3 cut(s) 1913, 2725, 2763
Bsh1236I CGCG 1 cut(s) 3285
BshVI ATCGAT 1 cut(s) 1923
BsiHKAI GWGCWC 5 cut(s) 276, 408, 1065, 1944, 2869
BsiHKCI CYCGRG 4 cut(s) 1099, 1716, 1982, 2177
BsiSI CCGG 4 cut(s) 82, 1100, 1717, 2966
BsiWI CGTACG 2 cut(s) 346, 2945
BslFI GGGAC 3 cut(s) 2152, 2788, 3542
BslI CCNNNNNNNGG 2 cut(s) 2789, 3390
BsmBI CGTCTC 2 cut(s) 2933, 3514
BsmFI GGGAC 3 cut(s) 2152, 2788, 3542
BsmI GAATGC 1 cut(s) 3086
Bso31I GGTCTC 1 cut(s) 2178
BsoBI CYCGRG 4 cut(s) 1099, 1716, 1982, 2177
Bsp119I TTCGAA 2 cut(s) 708, 1665
Bsp120I GGGCCC 1 cut(s) 388
Bsp1286I GDGCHC 7 cut(s) 276, 392, 408, 1065, 1178, 1944, 2869
Bsp19I CCATGG 1 cut(s) 2708
Bsp68I TCGCGA 1 cut(s) 3285
BspACI CCGC 4 cut(s) 6, 472, 1858, 2284
BspCNI CTCAG 6 cut(s) 49, 420, 667, 1756, 1773, 3555
BspDI ATCGAT 1 cut(s) 1923
BspFNI CGCG 1 cut(s) 3285
BspLI GGNNCC 3 cut(s) 390, 1177, 3477
BspMI ACCTGC 2 cut(s) 187, 2712
BspPI GGATC 6 cut(s) 329, 1632, 2805, 2865, 3177, 3343
BspQI GCTCTTC 1 cut(s) 2208
BspT104I TTCGAA 2 cut(s) 708, 1665
BspTI CTTAAG 2 cut(s) 1460, 2219
BspTNI GGTCTC 1 cut(s) 2178
BsrBI CCGCTC 1 cut(s) 2286
BsrDI GCAATG 3 cut(s) 669, 723, 1192
BsrI ACTGG 5 cut(s) 159, 621, 1217, 2469, 2667
BssT1I CCWWGG 2 cut(s) 1996, 2708
Bst2UI CCWGG 5 cut(s) 560, 954, 1946, 2109, 2531
Bst4CI ACNGT 4 cut(s) 306, 2758, 2819, 3388
Bst6I CTCTTC 2 cut(s) 703, 2208
BstAFI CTTAAG 2 cut(s) 1460, 2219
BstBAI YACGTR 1 cut(s) 1648
BstBI TTCGAA 2 cut(s) 708, 1665
BstC8I GCNNGC 4 cut(s) 715, 1551, 1892, 3562
BstDSI CCRYGG 1 cut(s) 2708
BstF5I GGATG 8 cut(s) 30, 172, 268, 625, 808, 2994, 3014, 3302
BstFNI CGCG 1 cut(s) 3285
BstNI CCWGG 5 cut(s) 560, 954, 1946, 2109, 2531
BstSFI CTRYAG 1 cut(s) 1743
BstSLI GKGCMC 3 cut(s) 276, 392, 2869
BstUI CGCG 1 cut(s) 3285
BstV1I GCAGC 6 cut(s) 446, 704, 1872, 2247, 2267, 2726
BstV2I GAAGAC 8 cut(s) 1215, 2192, 2399, 2465, 2597, 2663, 2678, 3202
BstX2I RGATCY 5 cut(s) 292, 334, 1624, 1693, 3348
BstXI CCANNNNNNTGG 1 cut(s) 1621
BstYI RGATCY 5 cut(s) 292, 334, 1624, 1693, 3348
Bsu15I ATCGAT 1 cut(s) 1923
Bsu36I CCTNAGG 2 cut(s) 36, 1764
BsuTUI ATCGAT 1 cut(s) 1923
BtgI CCRYGG 1 cut(s) 2708
BtrI CACGTC 2 cut(s) 2745, 2927
BtsCI GGATG 8 cut(s) 30, 172, 268, 625, 808, 2994, 3014, 3302
BtsIMutI CAGTG 7 cut(s) 614, 2396, 2462, 2594, 2660, 3384, 3550
BtuMI TCGCGA 1 cut(s) 3285
BveI ACCTGC 2 cut(s) 187, 2712
Cac8I GCNNGC 4 cut(s) 715, 1551, 1892, 3562
Cfr13I GGNCC 6 cut(s) 388, 389, 556, 874, 950, 1768
Cfr9I CCCGGG 2 cut(s) 1099, 1716
ClaI ATCGAT 1 cut(s) 1923
Csp6I GTAC 6 cut(s) 347, 867, 1571, 1590, 2527, 2946
CspCI CAANNNNNGTGG 2 cut(s) 1110, 1145
CviQI GTAC 6 cut(s) 347, 867, 1571, 1590, 2527, 2946
EaeI YGGCCR 3 cut(s) 3, 819, 1611
Eam1104I CTCTTC 2 cut(s) 703, 2208
EarI CTCTTC 2 cut(s) 703, 2208
Ecl136II GAGCTC 1 cut(s) 1063
Eco130I CCWWGG 2 cut(s) 1996, 2708
Eco147I AGGCCT 1 cut(s) 3311
Eco24I GRGCYC 3 cut(s) 392, 1065, 1178
Eco31I GGTCTC 1 cut(s) 2178
Eco32I GATATC 2 cut(s) 1324, 3502
Eco53kI GAGCTC 1 cut(s) 1063
Eco57I CTGAAG 8 cut(s) 818, 1614, 2345, 2354, 2411, 2477, 2609, 2675
Eco81I CCTNAGG 2 cut(s) 36, 1764
Eco88I CYCGRG 4 cut(s) 1099, 1716, 1982, 2177
EcoICRI GAGCTC 1 cut(s) 1063
EcoO109I RGGNCCY 4 cut(s) 388, 556, 874, 1768
EcoRI GAATTC 1 cut(s) 2251
EcoRII CCWGG 5 cut(s) 558, 952, 1944, 2107, 2529
EcoRV GATATC 2 cut(s) 1324, 3502
EcoT14I CCWWGG 2 cut(s) 1996, 2708
EcoT22I ATGCAT 3 cut(s) 1470, 1677, 3077
EcoT38I GRGCYC 3 cut(s) 392, 1065, 1178
ErhI CCWWGG 2 cut(s) 1996, 2708
Esp3I CGTCTC 2 cut(s) 2933, 3514
FalI AAGNNNNNCTT 2 cut(s) 2224, 2256
FaqI GGGAC 3 cut(s) 2152, 2788, 3542
FauI CCCGC 1 cut(s) 465
FauNDI CATATG 1 cut(s) 1851
FbaI TGATCA 1 cut(s) 2340
Fnu4HI GCNGC 8 cut(s) 6, 435, 718, 1861, 2236, 2281, 2284, 2740
FokI GGATG 8 cut(s) 17, 179, 275, 632, 815, 3001, 3021, 3289
FriOI GRGCYC 3 cut(s) 392, 1065, 1178
Fsp4HI GCNGC 8 cut(s) 6, 435, 718, 1861, 2236, 2281, 2284, 2740
FspBI CTAG 4 cut(s) 927, 1691, 2717, 2750
GluI GCNGC 8 cut(s) 6, 435, 718, 1861, 2236, 2281, 2284, 2740
GsuI CTGGAG 4 cut(s) 176, 1164, 1812, 2543
HapII CCGG 4 cut(s) 82, 1100, 1717, 2966
HincII GTYRAC 1 cut(s) 1726
HindII GTYRAC 1 cut(s) 1726
HindIII AAGCTT 6 cut(s) 209, 711, 2051, 2183, 3026, 3562
HpaII CCGG 4 cut(s) 82, 1100, 1717, 2966
HphI GGTGA 8 cut(s) 85, 168, 944, 1115, 1232, 1454, 3406, 3496
Hpy166II GTNNAC 5 cut(s) 274, 791, 1571, 1726, 2867
Hpy8I GTNNAC 5 cut(s) 274, 791, 1571, 1726, 2867
Hpy99I CGWCG 2 cut(s) 1569, 3528
HpyCH4III ACNGT 4 cut(s) 306, 2758, 2819, 3388
HpyCH4IV ACGT 6 cut(s) 379, 1647, 1918, 2744, 2926, 2993
HpySE526I ACGT 6 cut(s) 379, 1647, 1918, 2744, 2926, 2993
Ksp22I TGATCA 1 cut(s) 2340
LguI GCTCTTC 1 cut(s) 2208
LmnI GCTCC 4 cut(s) 1181, 2084, 2262, 2871
Lsp1109I GCAGC 6 cut(s) 446, 704, 1872, 2247, 2267, 2726
LweI GCATC 9 cut(s) 39, 1366, 1455, 1662, 2094, 2729, 2878, 2930, 3311
MaeI CTAG 4 cut(s) 927, 1691, 2717, 2750
MaeII ACGT 6 cut(s) 379, 1647, 1918, 2744, 2926, 2993
MaeIII GTNAC 4 cut(s) 970, 2745, 3062, 3164
MbiI CCGCTC 1 cut(s) 2286
MfeI CAATTG 2 cut(s) 195, 2344
MflI RGATCY 5 cut(s) 292, 334, 1624, 1693, 3348
MhlI GDGCHC 7 cut(s) 276, 392, 408, 1065, 1178, 1944, 2869
MlsI TGGCCA 2 cut(s) 821, 1613
MluNI TGGCCA 2 cut(s) 821, 1613
MmeI TCCRAC 1 cut(s) 544
Mox20I TGGCCA 2 cut(s) 821, 1613
Mph1103I ATGCAT 3 cut(s) 1470, 1677, 3077
MroXI GAANNNNTTC 4 cut(s) 89, 380, 1500, 3258
MscI TGGCCA 2 cut(s) 821, 1613
MslI CAYNNNNRTG 4 cut(s) 105, 1353, 1613, 1619
Msp20I TGGCCA 2 cut(s) 821, 1613
MspCI CTTAAG 2 cut(s) 1460, 2219
MspI CCGG 4 cut(s) 82, 1100, 1717, 2966
MunI CAATTG 2 cut(s) 195, 2344
Mva1269I GAATGC 1 cut(s) 3086
MvaI CCWGG 5 cut(s) 560, 954, 1946, 2109, 2531
MvnI CGCG 1 cut(s) 3285
NciI CCSGG 6 cut(s) 82, 1100, 1101, 1717, 1718, 2967
NcoI CCATGG 1 cut(s) 2708
NdeI CATATG 1 cut(s) 1851
NlaIV GGNNCC 3 cut(s) 390, 1177, 3477
NmuCI GTSAC 2 cut(s) 2745, 3164
NruI TCGCGA 1 cut(s) 3285
NsiI ATGCAT 3 cut(s) 1470, 1677, 3077
NspV TTCGAA 2 cut(s) 708, 1665
PaeR7I CTCGAG 2 cut(s) 1982, 2177
PaqCI CACCTGC 1 cut(s) 187
PceI AGGCCT 1 cut(s) 3311
PciSI GCTCTTC 1 cut(s) 2208
PctI GAATGC 1 cut(s) 3086
PdmI GAANNNNTTC 4 cut(s) 89, 380, 1500, 3258
Pfl23II CGTACG 2 cut(s) 346, 2945
PfoI TCCNGGA 1 cut(s) 2965
PkrI GCNGC 8 cut(s) 7, 436, 719, 1862, 2237, 2282, 2285, 2741
Ppu21I YACGTR 1 cut(s) 1648
PshBI ATTAAT 1 cut(s) 2952
Psp124BI GAGCTC 1 cut(s) 1065
Psp1406I AACGTT 1 cut(s) 379
Psp6I CCWGG 5 cut(s) 558, 952, 1944, 2107, 2529
PspGI CCWGG 5 cut(s) 558, 952, 1944, 2107, 2529
PspLI CGTACG 2 cut(s) 346, 2945
PspN4I GGNNCC 3 cut(s) 390, 1177, 3477
PspOMI GGGCCC 1 cut(s) 388
PspPI GGNCC 6 cut(s) 388, 389, 556, 874, 950, 1768
PsuI RGATCY 5 cut(s) 292, 334, 1624, 1693, 3348
RruI TCGCGA 1 cut(s) 3285
RsaI GTAC 6 cut(s) 348, 868, 1572, 1591, 2528, 2947
RsaNI GTAC 6 cut(s) 347, 867, 1571, 1590, 2527, 2946
RseI CAYNNNNRTG 4 cut(s) 105, 1353, 1613, 1619
SacI GAGCTC 1 cut(s) 1065
SapI GCTCTTC 1 cut(s) 2208
SatI GCNGC 8 cut(s) 6, 435, 718, 1861, 2236, 2281, 2284, 2740
Sau96I GGNCC 6 cut(s) 388, 389, 556, 874, 950, 1768
SduI GDGCHC 7 cut(s) 276, 392, 408, 1065, 1178, 1944, 2869
SfaNI GCATC 9 cut(s) 39, 1366, 1455, 1662, 2094, 2729, 2878, 2930, 3311
SfcI CTRYAG 1 cut(s) 1743
Sfr274I CTCGAG 2 cut(s) 1982, 2177
SfuI TTCGAA 2 cut(s) 708, 1665
SlaI CTCGAG 2 cut(s) 1982, 2177
SmaI CCCGGG 2 cut(s) 1101, 1718
SmiMI CAYNNNNRTG 4 cut(s) 105, 1353, 1613, 1619
SseBI AGGCCT 1 cut(s) 3311
SsiI CCGC 4 cut(s) 6, 472, 1858, 2284
SspI AATATT 4 cut(s) 1185, 1451, 2956, 3022
SspMI CTAG 4 cut(s) 927, 1691, 2717, 2750
SstI GAGCTC 1 cut(s) 1065
StuI AGGCCT 1 cut(s) 3311
StyI CCWWGG 2 cut(s) 1996, 2708
TaaI ACNGT 4 cut(s) 306, 2758, 2819, 3388
TaiI ACGT 6 cut(s) 382, 1650, 1921, 2747, 2929, 2996
TatI WGTACW 2 cut(s) 866, 1570
TauI GCSGC 2 cut(s) 8, 2286
TscAI CASTG 7 cut(s) 621, 2403, 2469, 2601, 2667, 3391, 3550
TseFI GTSAC 2 cut(s) 2745, 3164
TseI GCWGC 6 cut(s) 434, 717, 1860, 2235, 2280, 2739
Tsp45I GTSAC 2 cut(s) 2745, 3164
TspGWI ACGGA 4 cut(s) 1168, 1426, 2884, 3115
TspMI CCCGGG 2 cut(s) 1099, 1716
TspRI CASTG 7 cut(s) 621, 2403, 2469, 2601, 2667, 3391, 3550
Vha464I CTTAAG 2 cut(s) 1460, 2219
VneI GTGCAC 2 cut(s) 272, 2865
VspI ATTAAT 1 cut(s) 2952
XhoI CTCGAG 2 cut(s) 1982, 2177
XmaI CCCGGG 2 cut(s) 1099, 1716
XmnI GAANNNNTTC 4 cut(s) 89, 380, 1500, 3258
XspI CTAG 4 cut(s) 927, 1691, 2717, 2750
Zsp2I ATGCAT 3 cut(s) 1470, 1677, 3077
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.