Rmu_sc0003674.1_g000007

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003674.1
Physical Location & Seq
Reverse (-)
14454 .. 21510
7057 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003674.1_g000007.1.cds

Sequence Viewer

Length: 5232 bp
atggaccctgcttcctcttcttcttcttcttcttcttcttcttcatcttcattgacctatgatgtcttcctcagttttagaggcgaagacacccgacagagctttgtctgccatcttcacaaagctctggaaaaggcactcaaagtctacattgataaagaagatcttaaaaaaggcgaccgcctttcggatctactgaaagccattgctgaatcaaagctttcgattgtagttttctctgagaactacgggaattccacatggtgcttgaaagaactggtgcagattatggaatacgaggagaagcacaagcagattgtgatacccgttttctacaaagtagatccttctcacattcgtaaacagacgggaaggtttggcaaagcttatgacgagcatgagcgcaaatgcaaaaaggacaagaagttgctgaaagaagtgcagagatggagacccgctttaagcaaagccgctgacttaagtggctgggattccaattccaaagattttggggatgatgccaagctcattgagcgtattgtaaatgatgtccttgataaagtgaatcggatctcgccacacatagaggatggcttggttgcaatggattcccatctgcgtcaagtgggacgactattaaatgatgcgccggatgatgctgtctatgtcggaatctggggaatgggcggcttgggtaaaaccaccattgccagggctgtttataacagaatttctcatcaatttgactaccgttgctttcttaaaaatgtgagggaacgcttcaagagcaaaggtgaagtagaaatgcaacttcaatttctatctgaaatctttaagggaatagtcaacaatttcgatggggatcacatgatgtggttggaaaggctacgtaagaaaaaaatcctagttgttcttgacgatgtactcgattcaagccagattgataccttgctcggagagaaacgttcatttggtggtggaagtataattattgtaacaactagagatgaacatgtggtgcgtggatttgagatatacaagcccgagccattaagtgatgaagatgctctgaaactcttcagccagaaggccttcgacacatgcaaaccccctggagagtatgaacatctctcaaagtgcatagcagaatatgcacgcggtctgcccttagcacttatagtattgggaaagtttcttcgtaagagaagtgtagatcactgggaaggtcagctcaagaaattgaaggaatgtccgcacgcagatattgagaacgtgcttaaaataagctatgatggactagagccttgtcagcaggtcatatttctagatattgcatgtttctttaaaggaatggagaaagactatgtaacaaaagttcttgccaattgtgactgcatcagtcccggccttgacttagatgttctagttgaaagagctcttgtaactgtctcatattccaatcaacttgagatgcacgatttactacaagaaatgggtagacaaattgaaaaagacgggaagcggagtagattttggggtgaagaagctgagcgtgtgcttactgaaaatacggctacggaaaatgctggacgcttgatgattgacttgccgaaaaaggaaggcggatccttcaatacttcaatgcgcatattcacttacgggcaaaggtattctggagatgacggtcaaaatcacttgactggggaattcaattttctttctcgtgagttgaaggttctcgtctggcatggatatccccaaaagtgtttgccatccaactttgaccccaaaaatcttgttcagcttgacatgccttacagtaacattgaacaacaactttgggaaggatccaagccggcgaaaaagttggcaatcatcgatttgagtggctcttcatgtcttaaaagaatccctgacttgactcttgtgacaaatctaaaggaactccattttgatcgttgttcaagtttaaaggaggttcacccatccatttcatctcttaaaaaccttgttttatttagtttagcaggatgcgatgaacttaagagtcttcctggcagcattgatcaaatgaagtctctcaaaacccttgatcttcaccactgcttaaattttgagatatttccagagatttcggaagttatggaggcactatcaaagcttgatttattgcaaacagcaattaaggagttaccatcgtcaattgaacggcttcgggggcttaaatcattagacatgacattctgttttagccttatccgtcttccagacagtatctgtaatttagcagaacttagatctctcagcttgagagattgctcaaaactttgcaagttgcctgagaacattgggaatttagaatctttgttggaatttcaagtacacggaactggtttagaacaactgccgatctctatattacgtctgaaggtcggtgaattatacttttcttgttgccgaaaaatggctgctcccctttcatcatggccatcatcaattgaagattgttgtactgctgtgctacatcttgatttacgttattgcaatctgttggaattatcagatgctattgctcatttttcttcattgaaagcattaacgttgtcaagaaatgacaatttggagagcttacctgcaatcatgaatagacttgcttccttagaaaagcttgaattggacggttgcaagagtctgagatcaataccagagctttcatcaacaataagttacataaacgcacatgattgcagagctttggaatctgtttcgacaccacagtctccctacgatgtcggtcggtgcttcatattttctaattgcagtcagctggtacagaaagatgttttcagagatattgtaaaaactcatttgcctcctcagggtaatcgttcccgacccttttatgtctctttgcctggaagtgaaattccagagtggttcacccatcagtgtagggggtcttctgtaactgccaagctaccaccaaattggtttgacaacaagtttttgggctttactgtatgtgcggttattaataagacccaggatgagatcattgcgagtatcgcttcacgtccagattcttttcttcgactgactgctcgatgtttctgtaccttcaaaggagatcatcgcgagtaccgtttcagtttctatttgtttgatcttcgatgtttcgacagtgatggttgttggctcgagtcaaatcacatgttactgggatatgtgccatggtctgaatctggcatgattaagagagaggaagtcattaagagagaggaagtcaatgaacgccgttacacagaggccaaatttgagatacaattgcacgatgggtcgagtcatagatacacattgagtgatagattcaaaccatgcatcgaaaggtgcggagttcgattcctttttgccaacaatgaggaagattttggggaaccaatggcagaagttgataattctgagaggagctttgaggggtgctcggctgaacccagtggcactgacatcacaaatgaggatgagcaataccttaaattatcacaagtttttaaaggcgcaaacagagcatggagtttcaacaaatttgaggacaatgatttatctgggaagaggaaaactctggaaaggtggacgcaaaaagtcagagttacatcgggtctgatgcaagggcctgtggatgatggttttaaatggaaatcggatggcggtggaatcgacggggttagctattattgtggttactgttcggcaagagccataaagccaactcaggatgacccaacaatctgtcaaattacttacgttgggaggcacacttgttggaaatttcaaccaatgctaacacaccaagtaggagttacaccgggtatgaggattgaaggtccttttgatggttttacatggggggagtatgaccaaacggacataccaggatctgaatacccaagagtctattattacgtatgcactcctcaaaatgtcaaaggctgcatggccataaaggaagtgcaacactccagtgatcaaaaaatcctgaaaattacttacagaggaaggcacacatgtatagaagcctccgacagcattgcaggatggtttgaaagactaaagtccaagggcagtgttgaatcaagttttcatgaacaagttcccctatcaccaagctcaccaggagccaactcacaagatatgtcaaatagaaaggaagttactgcaaagaaaagcaaaggtgaagaagtggctgagcttgaagttgagaagacagaaaagaagaagaagaagaagaagaaaaaggataaagacaatggtgttttggattcttcagatggggagaaatctgtgaaggtgaagaggcacgaaggtaaagaagaagctggttcacctcaaactgaaaagtctgaaaagaagaaaaagaagaaaaacaaagaggctcaggatcatggtgctgatgctgccactgataatggcaagggtgatggtgaagctgataagagtgggaaaaagaaggagaagaagaagcgcaaacaagaggaaataattgacagtcctgtttcagttcctgcaaagaaaagcaaaggtgaagaagcggctgagcttaaagttgagaagtcagaaaagaagaagaagaagaaaaaggataaagacaatggtgttttggattcttcagatggggagaaatctgtgaatgtggagaagcacaaagataaagaagaagctggttcacctcaaactgaaaagtctgaaaagaagaaaaagaagaaaaacaaagaggctcaggatcatggtgctgatgttgccactgataatggcaagggtgatggtgaggctgataagagtgagaaaaagaaggagaagaagaagcgcaaacaagaggaaataactaacagtcctgttacagttcctgcaaagaaaggcaaaggtgaagaagtggctgggcttgaagttgagaagacagaaaagaagaagaagaagaaaaaggataaagacaatggtgttttggattcttcatatggggagaaatctgtgaaggtgaagaagcacacagataaagaagaagctggttcacctcaaactgagaagtctgaaaagaagaaaaacaaagaggctgaggatcatagtgttgatgctgccactgataacagcaagggtgatggtgaggctgataagagtgagaaaaagaagaagaagaagaagaagaagaaaaaggataaatcggatgctgacgaagaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1743

Amino Acids

196.97

Weight (kDa)

8.21

Isoelectric Point (pI)

40.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000067)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g01690 FvH4_6g01690 FvH4_7g11151 FvH4_7g11160 FvH4_7g11570 FvH4_7g17700 FvH4_7g26071 FvH4_7g28510 FvH4_7g28520 FvH4_7g28530 FvH4_7g28540 FvH4_7g28540 FvH4_7g28540 FvH4_7g28540 FvH4_7g28540 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550 FvH4_7g28550
malus_domestica MD00G1020300.v1.1 MD00G1020400.v1.1 MD00G1020500.v1.1 MD00G1020700.v1.1 MD00G1021100.v1.1 MD00G1131100.v1.1 MD01G1188900.v1.1 MD01G1189000.v1.1 MD01G1189200.v1.1 MD01G1190100.v1.1 MD01G1190300.v1.1 MD01G1190500.v1.1 MD01G1190700.v1.1 MD01G1191400.v1.1 MD02G1260000.v1.1 MD02G1260200.v1.1 MD02G1260400.v1.1 MD03G1202400.v1.1 MD04G1022500.v1.1 MD04G1022700.v1.1 MD04G1200400.v1.1 MD07G1015300.v1.1 MD07G1015400.v1.1 MD07G1141800.v1.1 MD07G1242100.v1.1 MD07G1242500.v1.1 MD07G1243000.v1.1 MD07G1243500.v1.1 MD07G1244000.v1.1 MD07G1244600.v1.1 MD07G1245100.v1.1 MD07G1245600.v1.1 MD07G1246000.v1.1 MD07G1246200.v1.1 MD07G1260000.v1.1 MD07G1260700.v1.1 MD07G1261100.v1.1 MD08G1229600.v1.1 MD08G1229700.v1.1 MD08G1230200.v1.1 MD09G1186700.v1.1 MD09G1186800.v1.1 MD17G1208600.v1.1
pyrus_communis pycom01g20080 pycom01g20090 pycom01g20120 pycom01g20130 pycom01g20160 pycom01g20200 pycom01g20210 pycom01g20250 pycom02g22140 pycom02g22170 pycom02g22200 pycom02g22220 pycom02g22230 pycom03g15410 pycom03g15420 pycom04g01960 pycom04g01970 pycom07g21840 pycom07g21930 pycom07g21960 pycom07g22000 pycom07g23350 pycom07g23370 pycom07g23440 pycom07g23450 pycom07g23460 pycom07g23500 pycom07g23530 pycom07g23590 pycom07g23660 pycom07g23670 pycom07g23690 pycom07g23710 pycom07g23760 pycom07g23770 pycom07g23780 pycom07g23800 pycom07g23820 pycom08g19980 pycom08g19990 pycom08g20010 pycom08g20020 pycom17g04750 pycom17g21140 pycom17g21200 pycom17g21250 pycom17g21270 pycom17g21290 pycom17g21340 pycom17g21350
rosa_chinensis RchiOBHm_Chr1g0335971 RchiOBHm_Chr1g0349181 RchiOBHm_Chr1g0349211 RchiOBHm_Chr1g0349221 RchiOBHm_Chr1g0350001 RchiOBHm_Chr1g0372491 RchiOBHm_Chr1g0372501 RchiOBHm_Chr1g0372511 RchiOBHm_Chr1g0372541 RchiOBHm_Chr1g0375911 RchiOBHm_Chr1g0375921 RchiOBHm_Chr1g0375931 RchiOBHm_Chr1g0375941 RchiOBHm_Chr1g0375951 RchiOBHm_Chr3g0454321 RchiOBHm_Chr6g0266131 RchiOBHm_Chr6g0270371 RchiOBHm_Chr6g0270381 RchiOBHm_Chr6g0270391 RchiOBHm_Chr7g0232121 RchiOBHm_Chr7g0232831
rosa_laevigata RLG00000008620 RLG00000009600 RLG00000010114 RLG00000020933 RLG00000022777 RLG00000022778 RLG00000025461 RLG00000025462 RLG00000026641 RLG00000026642 RLG00000026643 RLG00000026894 RLG00000028442 RLG00000028506 RLG00000028510 RLG00000028563 RLG00000028564 RLG00000028570 RLG00000028574 RLG00000028577 RLG00000028579 RLG00000028580 RLG00000028582 RLG00000028584 RLG00000028588 RLG00000028591 RLG00000028592 RLG00000028596
rosa_multiflora Rmu_co8179714.1_g000001 Rmu_co8285207.1_g000001 Rmu_co8469031.1_g000001 Rmu_co8499245.1_g000002 Rmu_sc0000616.1_g000011 Rmu_sc0000827.1_g000022 Rmu_sc0000827.1_g000025 Rmu_sc0000827.1_g000034 Rmu_sc0000827.1_g000036 Rmu_sc0001340.1_g000001 Rmu_sc0001909.1_g000018 Rmu_sc0002863.1_g000018 Rmu_sc0002863.1_g000031 Rmu_sc0002914.1_g000028 Rmu_sc0002914.1_g000029 Rmu_sc0002914.1_g000032 Rmu_sc0003385.1_g000001 Rmu_sc0003385.1_g000008 Rmu_sc0003385.1_g000009 Rmu_sc0003385.1_g000013 Rmu_sc0003385.1_g000015 Rmu_sc0003385.1_g000025 Rmu_sc0003441.1_g000069 Rmu_sc0003674.1_g000007 Rmu_sc0003674.1_g000011 Rmu_sc0004618.1_g000001 Rmu_sc0005410.1_g000018 Rmu_sc0006415.1_g000005 Rmu_sc0006415.1_g000006 Rmu_sc0006415.1_g000014 Rmu_sc0006415.1_g000018 Rmu_sc0009606.1_g000011 Rmu_sc0011111.1_g000006 Rmu_sc0011709.1_g000003 Rmu_sc0011709.1_g000006 Rmu_sc0014584.1_g000002 Rmu_sc0015952.1_g000001 Rmu_sc0019347.1_g000001 Rmu_sc0019347.1_g000002 Rmu_sc0019347.1_g000003 Rmu_sc0023808.1_g000001 Rmu_sc0032581.1_g000001 Rmu_sc0034725.1_g000002 Rmu_sc0035038.1_g000001 Rmu_ssc0000018.1_g000005 Rmu_ssc0000018.1_g000006 Rmu_ssc0000116.1_g000002 Rmu_ssc0000150.1_g000009 Rmu_ssc0000150.1_g000011 Rmu_ssc0000472.1_g000013
rosa_roxburghii Rroxscaffold_165G00437140 Rroxscaffold_174G00435220 Rroxscaffold_3G00228770 Rroxscaffold_3G00228780 Rroxscaffold_4G00282480 Rroxscaffold_4G00282490 Rroxscaffold_4G00282510 Rroxscaffold_4G00282520 Rroxscaffold_4G00282540 Rroxscaffold_4G00284870 Rroxscaffold_4G00295380 Rroxscaffold_4G00305140 Rroxscaffold_4G00305150 Rroxscaffold_4G00305210 Rroxscaffold_4G00305760 Rroxscaffold_4G00305810 Rroxscaffold_4G00305840 Rroxscaffold_4G00305900 Rroxscaffold_4G00305920 Rroxscaffold_4G00305960 Rroxscaffold_4G00305980 Rroxscaffold_4G00305990 Rroxscaffold_4G00306020 Rroxscaffold_4G00325020 Rroxscaffold_5G00352760 Rroxscaffold_6G00425210 Rroxscaffold_7G00201950 Rroxscaffold_7G00214940
rosa_rugosa Rorug01G0048900 Rorug01G0049000 Rorug01G0201400 Rorug01G0201700 Rorug01G0202000 Rorug01G0207700 Rorug01G0207800 Rorug01G0207900 Rorug01G0286300 Rorug01G0286400 Rorug01G0286500 Rorug01G0372500 Rorug01G0372600 Rorug01G0392300 Rorug01G0392400 Rorug01G0392500 Rorug01G0392600 Rorug01G0392700 Rorug01G0392800 Rorug01G0392800 Rorug01G0392900 Rorug01G0393000 Rorug02G0654200 Rorug02G0654200 Rorug04G0027700 Rorug05G0351300 Rorug05G0351400 Rorug05G0351600 Rorug05G0406600 Rorug07G0269500 Rorug07G0276200 Rorug07G0276200
rosa_samantha Rh1AG224200 Rh1AG229900 Rh1AG297600 Rh1AG297700 Rh1AG381000 Rh1AG404200 Rh1AG404300 Rh1AG404400 Rh1BG184300 Rh1BG367600 Rh1BG367900 Rh1BG368000 Rh1CG203700 Rh1CG208900 Rh1CG279000 Rh1CG279100 Rh1CG357900 Rh1CG380500 Rh1CG380700 Rh1CG380800 Rh1CG380900 Rh1DG214000 Rh3AG058200 Rh3BG059900 Rh6BG145500 Rh6BG292400 Rh6DG129800 Rh7AG423900 Rh7AG431300 Rh7BG249300 Rh7BG404200 Rh7CG049400 Rh7CG444300 Rh7CG450000 Rh7DG420600
rosa_wichuraiana Rw0G000410 Rw0G007570 Rw0G011870 Rw1G018580 Rw1G018590 Rw1G018610 Rw1G018620 Rw1G018640 Rw1G019140 Rw1G019150 Rw1G019260 Rw1G019900 Rw1G026290 Rw1G026300 Rw1G026870 Rw1G026890 Rw1G033510 Rw1G035810 Rw1G035830 Rw1G035840 Rw1G035850 Rw1G035860 Rw3G004460 Rw5G038750 Rw7G035060 Rw7G035610

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 723
AasI GACNNNNNNGTC 1 cut(s) 2776
Acc16I TGCGCA 1 cut(s) 1646
Acc36I ACCTGC 2 cut(s) 1303, 2641
AccI GTMKAC 2 cut(s) 147, 1498
AccII CGCG 2 cut(s) 1158, 3135
AclI AACGTT 2 cut(s) 964, 2600
AcoI YGGCCR 2 cut(s) 2486, 3993
AcuI CTGAAG 4 cut(s) 1063, 2447, 4305, 4647
AdeI CACNNNGTG 1 cut(s) 264
AfaI GTAC 6 cut(s) 924, 2382, 2512, 2832, 3115, 3140
AfiI CCNNNNNNNGG 5 cut(s) 187, 711, 2464, 2879, 3890
AflII CTTAAG 2 cut(s) 478, 2042
AflIII ACRYGT 3 cut(s) 1012, 3210, 4061
AjiI CACGTC 1 cut(s) 3074
AjnI CCWGG 7 cut(s) 710, 1111, 2053, 2914, 3042, 3928, 4168
AleI CACNNNNGTG 1 cut(s) 4017
Alw21I GWGCWC 2 cut(s) 1438, 3482
Alw26I GTCTC 5 cut(s) 445, 1453, 2082, 2784, 2911
AlwNI CAGNNNCTG 4 cut(s) 2277, 3935, 4559, 4901
Ama87I CYCGRG 2 cut(s) 1043, 3197
AoxI GGCC 6 cut(s) 1089, 1405, 2486, 3306, 3668, 3993
ApeKI GCWGC 5 cut(s) 2058, 2468, 3987, 4451, 5126
AseI ATTAAT 1 cut(s) 3033
Asp700I GAANNNNTTC 4 cut(s) 1076, 1091, 2211, 4146
AspLEI GCGC 6 cut(s) 405, 649, 1647, 3557, 4521, 4863
AspS9I GGNCC 3 cut(s) 4, 3668, 3881
AsuC2I CCSGG 2 cut(s) 1404, 3864
AvaI CYCGRG 2 cut(s) 1043, 3197
AvaII GGWCC 2 cut(s) 4, 3881
AxyI CCTNAGG 1 cut(s) 2877
BalI TGGCCA 2 cut(s) 2488, 3995
BamHI GGATCC 2 cut(s) 1625, 1847
BanII GRGCYC 1 cut(s) 1438
BarI GAAGNNNNNNTAC 2 cut(s) 2944, 2976
BauI CACGAG 1 cut(s) 1722
BbsI GAAGAC 7 cut(s) 58, 93, 2042, 2255, 2952, 4265, 4955
Bbv12I GWGCWC 2 cut(s) 1438, 3482
BbvCI CCTCAGC 1 cut(s) 5106
BbvI GCAGC 5 cut(s) 2070, 2455, 3974, 4438, 5113
BceAI ACGGC 3 cut(s) 1587, 2225, 3279
BcgI CGANNNNNNTGC 2 cut(s) 4067, 4101
BciT130I CCWGG 7 cut(s) 712, 1113, 2055, 2916, 3044, 3930, 4170
BclI TGATCA 2 cut(s) 2065, 4021
BcnI CCSGG 2 cut(s) 1404, 3864
BcoDI GTCTC 5 cut(s) 445, 1453, 2082, 2784, 2911
BfaI CTAG 5 cut(s) 905, 1002, 1298, 1325, 1424
BfrI CTTAAG 2 cut(s) 478, 2042
BfuAI ACCTGC 2 cut(s) 1303, 2641
BglII AGATCT 2 cut(s) 163, 2297
BisI GCNGC 8 cut(s) 471, 688, 2059, 2469, 3988, 4452, 4587, 5127
BlpI GCTNAGC 3 cut(s) 1548, 4242, 4590
BlsI GCNGC 8 cut(s) 472, 689, 2060, 2470, 3989, 4453, 4588, 5128
Bme1390I CCNGG 9 cut(s) 712, 1113, 1404, 2055, 2916, 3044, 3864, 3930, 4170
Bme18I GGWCC 2 cut(s) 4, 3881
BmeT110I CYCGRG 2 cut(s) 1043, 3197
BmgBI CACGTC 1 cut(s) 3074
BmgT120I GGNCC 3 cut(s) 4, 3668, 3881
BmiI GGNNCC 5 cut(s) 6, 1627, 1849, 3435, 4174
BmrFI CCNGG 9 cut(s) 712, 1113, 1404, 2055, 2916, 3044, 3864, 3930, 4170
BmrI ACTGGG 4 cut(s) 1228, 1710, 3227, 3486
BmuI ACTGGG 4 cut(s) 1228, 1710, 3227, 3486
BoxI GACNNNNGTC 1 cut(s) 4108
BpiI GAAGAC 7 cut(s) 58, 93, 2042, 2255, 2952, 4265, 4955
BplI GAGNNNNNCTC 4 cut(s) 3464, 3496, 3601, 3633
BpmI CTGGAG 3 cut(s) 1134, 1695, 4000
Bpu10I CCTNAGC 4 cut(s) 1168, 4431, 4773, 5106
Bpu1102I GCTNAGC 3 cut(s) 1548, 4242, 4590
BpuEI CTTGAG 3 cut(s) 1217, 1487, 2329
BpuMI CCSGG 2 cut(s) 1404, 3864
Bsa29I ATCGAT 1 cut(s) 1878
BsaAI YACGTR 2 cut(s) 890, 3961
BsaBI GATNNNNATC 2 cut(s) 612, 861
BsaI GGTCTC 1 cut(s) 445
BsaJI CCNNGG 5 cut(s) 711, 1111, 3042, 3230, 4113
Bsc4I CCNNNNNNNGG 5 cut(s) 187, 711, 2464, 2879, 3890
Bse118I RCCGGY 1 cut(s) 1855
Bse1I ACTGG 7 cut(s) 282, 1223, 1705, 2395, 3222, 3492, 4017
Bse21I CCTNAGG 1 cut(s) 2877
Bse3DI GCAATG 5 cut(s) 204, 609, 705, 3054, 4083
Bse8I GATNNNNATC 2 cut(s) 612, 861
BseBI CCWGG 7 cut(s) 712, 1113, 2055, 2916, 3044, 3930, 4170
BseCI ATCGAT 1 cut(s) 1878
BseDI CCNNGG 5 cut(s) 711, 1111, 3042, 3230, 4113
BseJI GATNNNNATC 2 cut(s) 612, 861
BseLI CCNNNNNNNGG 5 cut(s) 187, 711, 2464, 2879, 3890
BseMI GCAATG 5 cut(s) 204, 609, 705, 3054, 4083
BseNI ACTGG 7 cut(s) 282, 1223, 1705, 2395, 3222, 3492, 4017
BseRI GAGGAG 4 cut(s) 314, 2865, 3478, 3960
BseXI GCAGC 5 cut(s) 2070, 2455, 3974, 4438, 5113
BseYI CCCAGC 2 cut(s) 486, 4931
BsgI GTGCAG 2 cut(s) 302, 461
Bsh1236I CGCG 2 cut(s) 1158, 3135
Bsh1285I CGRYCG 2 cut(s) 181, 2797
BshFI GGCC 6 cut(s) 1091, 1407, 2488, 3308, 3670, 3995
BshVI ATCGAT 1 cut(s) 1878
BsiEI CGRYCG 2 cut(s) 181, 2797
BsiHKAI GWGCWC 2 cut(s) 1438, 3482
BsiHKCI CYCGRG 2 cut(s) 1043, 3197
BsiSI CCGG 4 cut(s) 650, 1404, 1856, 3863
BslFI GGGAC 2 cut(s) 642, 1386
BslI CCNNNNNNNGG 5 cut(s) 187, 711, 2464, 2879, 3890
BsmAI GTCTC 5 cut(s) 445, 1453, 2082, 2784, 2911
BsmFI GGGAC 2 cut(s) 642, 1386
BsnI GGCC 6 cut(s) 1091, 1407, 2488, 3308, 3670, 3995
Bso31I GGTCTC 1 cut(s) 445
BsoBI CYCGRG 2 cut(s) 1043, 3197
Bsp1286I GDGCHC 2 cut(s) 1438, 3482
Bsp1720I GCTNAGC 3 cut(s) 1548, 4242, 4590
Bsp19I CCATGG 1 cut(s) 3230
Bsp68I TCGCGA 1 cut(s) 3135
BspANI GGCC 6 cut(s) 1091, 1407, 2488, 3308, 3670, 3995
BspDI ATCGAT 1 cut(s) 1878
BspFNI CGCG 2 cut(s) 1158, 3135
BspHI TCATGA 2 cut(s) 2640, 4138
BspLI GGNNCC 5 cut(s) 6, 1627, 1849, 3435, 4174
BspMI ACCTGC 2 cut(s) 1303, 2641
BspQI GCTCTTC 1 cut(s) 1897
BspTI CTTAAG 2 cut(s) 478, 2042
BspTNI GGTCTC 1 cut(s) 445
BsrDI GCAATG 5 cut(s) 204, 609, 705, 3054, 4083
BsrFI RCCGGY 1 cut(s) 1855
BsrI ACTGG 7 cut(s) 282, 1223, 1705, 2395, 3222, 3492, 4017
BssAI RCCGGY 1 cut(s) 1855
BssECI CCNNGG 5 cut(s) 711, 1111, 3042, 3230, 4113
BssSI CACGAG 1 cut(s) 1722
BssT1I CCWWGG 2 cut(s) 3230, 4113
Bst2BI CACGAG 1 cut(s) 1722
Bst2UI CCWGG 7 cut(s) 712, 1113, 2055, 2916, 3044, 3930, 4170
Bst6I CTCTTC 5 cut(s) 22, 1082, 1897, 3602, 4343
BstAFI CTTAAG 2 cut(s) 478, 2042
BstAPI GCANNNNNTGC 1 cut(s) 1151
BstBAI YACGTR 2 cut(s) 890, 3961
BstC8I GCNNGC 3 cut(s) 1156, 1257, 1857
BstDSI CCRYGG 1 cut(s) 3230
BstFNI CGCG 2 cut(s) 1158, 3135
BstHHI GCGC 6 cut(s) 405, 649, 1647, 3557, 4521, 4863
BstMAI GTCTC 5 cut(s) 445, 1453, 2082, 2784, 2911
BstMCI CGRYCG 2 cut(s) 181, 2797
BstNI CCWGG 7 cut(s) 712, 1113, 2055, 2916, 3044, 3930, 4170
BstNSI RCATGY 6 cut(s) 1016, 1104, 1338, 1813, 3214, 4065
BstPAI GACNNNNGTC 1 cut(s) 4108
BstSCI CCNGG 9 cut(s) 710, 1111, 1402, 2053, 2914, 3042, 3862, 3928, 4168
BstSNI TACGTA 2 cut(s) 890, 3961
BstUI CGCG 2 cut(s) 1158, 3135
BstV1I GCAGC 5 cut(s) 2070, 2455, 3974, 4438, 5113
BstV2I GAAGAC 7 cut(s) 58, 93, 2042, 2255, 2952, 4265, 4955
BstX2I RGATCY 8 cut(s) 163, 190, 343, 570, 1625, 1847, 2297, 3932
BstXI CCANNNNNNTGG 1 cut(s) 2988
BstYI RGATCY 8 cut(s) 163, 190, 343, 570, 1625, 1847, 2297, 3932
Bsu15I ATCGAT 1 cut(s) 1878
Bsu36I CCTNAGG 1 cut(s) 2877
BsuRI GGCC 6 cut(s) 1091, 1407, 2488, 3308, 3670, 3995
BsuTUI ATCGAT 1 cut(s) 1878
BtgI CCRYGG 1 cut(s) 3230
BtgZI GCGATG 2 cut(s) 2049, 3116
BtrI CACGTC 1 cut(s) 3074
BtsI GCAGTG 2 cut(s) 2101, 4126
BtuMI TCGCGA 1 cut(s) 3135
BveI ACCTGC 2 cut(s) 1303, 2641
Cac8I GCNNGC 3 cut(s) 1156, 1257, 1857
CaiI CAGNNNCTG 4 cut(s) 2277, 3935, 4559, 4901
CciI TCATGA 2 cut(s) 2640, 4138
CfoI GCGC 6 cut(s) 405, 649, 1647, 3557, 4521, 4863
Cfr10I RCCGGY 1 cut(s) 1855
Cfr13I GGNCC 3 cut(s) 4, 3668, 3881
ClaI ATCGAT 1 cut(s) 1878
CseI GACGC 3 cut(s) 608, 1599, 3640
Csp6I GTAC 6 cut(s) 923, 2381, 2511, 2831, 3114, 3139
CviQI GTAC 6 cut(s) 923, 2381, 2511, 2831, 3114, 3139
DraI TTTAAA 4 cut(s) 1345, 1971, 3550, 3688
DraIII CACNNNGTG 1 cut(s) 264
DrdI GACNNNNNNGTC 1 cut(s) 2776
DseDI GACNNNNNNGTC 1 cut(s) 2776
EaeI YGGCCR 2 cut(s) 2486, 3993
Eam1104I CTCTTC 5 cut(s) 22, 1082, 1897, 3602, 4343
EarI CTCTTC 5 cut(s) 22, 1082, 1897, 3602, 4343
EciI GGCGGA 1 cut(s) 1638
Ecl136II GAGCTC 1 cut(s) 1436
Eco105I TACGTA 2 cut(s) 890, 3961
Eco130I CCWWGG 2 cut(s) 3230, 4113
Eco147I AGGCCT 1 cut(s) 1091
Eco24I GRGCYC 1 cut(s) 1438
Eco31I GGTCTC 1 cut(s) 445
Eco32I GATATC 1 cut(s) 1754
Eco47I GGWCC 2 cut(s) 4, 3881
Eco53kI GAGCTC 1 cut(s) 1436
Eco57I CTGAAG 4 cut(s) 1063, 2447, 4305, 4647
Eco81I CCTNAGG 1 cut(s) 2877
Eco88I CYCGRG 2 cut(s) 1043, 3197
EcoICRI GAGCTC 1 cut(s) 1436
EcoO109I RGGNCCY 2 cut(s) 3668, 3881
EcoRI GAATTC 2 cut(s) 253, 1706
EcoRII CCWGG 7 cut(s) 710, 1111, 2053, 2914, 3042, 3928, 4168
EcoRV GATATC 1 cut(s) 1754
EcoT14I CCWWGG 2 cut(s) 3230, 4113
EcoT22I ATGCAT 1 cut(s) 3380
EcoT38I GRGCYC 1 cut(s) 1438
ErhI CCWWGG 2 cut(s) 3230, 4113
FalI AAGNNNNNCTT 2 cut(s) 150, 182
FaqI GGGAC 2 cut(s) 642, 1386
FauI CCCGC 1 cut(s) 463
FauNDI CATATG 1 cut(s) 5008
FbaI TGATCA 2 cut(s) 2065, 4021
FblI GTMKAC 2 cut(s) 147, 1498
Fnu4HI GCNGC 8 cut(s) 471, 688, 2059, 2469, 3988, 4452, 4587, 5127
FriOI GRGCYC 1 cut(s) 1438
Fsp4HI GCNGC 8 cut(s) 471, 688, 2059, 2469, 3988, 4452, 4587, 5127
FspAI RTGCGCAY 1 cut(s) 1646
FspBI CTAG 5 cut(s) 905, 1002, 1298, 1325, 1424
FspI TGCGCA 1 cut(s) 1646
GlaI GCGC 6 cut(s) 404, 648, 1646, 3556, 4520, 4862
GluI GCNGC 8 cut(s) 471, 688, 2059, 2469, 3988, 4452, 4587, 5127
GsaI CCCAGC 2 cut(s) 490, 4935
GsuI CTGGAG 3 cut(s) 1134, 1695, 4000
HaeIII GGCC 6 cut(s) 1091, 1407, 2488, 3308, 3670, 3995
HapII CCGG 4 cut(s) 650, 1404, 1856, 3863
HgaI GACGC 3 cut(s) 608, 1599, 3640
HhaI GCGC 6 cut(s) 405, 649, 1647, 3557, 4521, 4863
Hin6I GCGC 6 cut(s) 403, 647, 1645, 3555, 4519, 4861
HinP1I GCGC 6 cut(s) 403, 647, 1645, 3555, 4519, 4861
HincII GTYRAC 1 cut(s) 847
HindII GTYRAC 1 cut(s) 847
HindIII AAGCTT 4 cut(s) 218, 384, 2159, 2666
HpaII CCGG 4 cut(s) 650, 1404, 1856, 3863
Hpy99I CGWCG 1 cut(s) 3719
HpyCH4IV ACGT 9 cut(s) 889, 964, 1272, 2422, 2536, 2600, 3073, 3801, 3960
HpySE526I ACGT 9 cut(s) 889, 964, 1272, 2422, 2536, 2600, 3073, 3801, 3960
HspAI GCGC 6 cut(s) 403, 647, 1645, 3555, 4519, 4861
KroI GCCGGC 1 cut(s) 1855
KroNI GCCGGC 1 cut(s) 1857
Ksp22I TGATCA 2 cut(s) 2065, 4021
LguI GCTCTTC 1 cut(s) 1897
LmnI GCTCC 3 cut(s) 2476, 3465, 4172
Lsp1109I GCAGC 5 cut(s) 2070, 2455, 3974, 4438, 5113
MaeI CTAG 5 cut(s) 905, 1002, 1298, 1325, 1424
MaeII ACGT 9 cut(s) 889, 964, 1272, 2422, 2536, 2600, 3073, 3801, 3960
MfeI CAATTG 4 cut(s) 1384, 2202, 2496, 3323
MflI RGATCY 8 cut(s) 163, 190, 343, 570, 1625, 1847, 2297, 3932
MhlI GDGCHC 2 cut(s) 1438, 3482
MlsI TGGCCA 2 cut(s) 2488, 3995
MluNI TGGCCA 2 cut(s) 2488, 3995
MlyI GAGTC 6 cut(s) 1915, 2056, 2698, 3209, 3349, 3957
MmeI TCCRAC 7 cut(s) 649, 858, 1800, 2349, 2532, 3800, 4101
Mox20I TGGCCA 2 cut(s) 2488, 3995
Mph1103I ATGCAT 1 cut(s) 3380
MroNI GCCGGC 1 cut(s) 1855
MroXI GAANNNNTTC 4 cut(s) 1076, 1091, 2211, 4146
MscI TGGCCA 2 cut(s) 2488, 3995
MslI CAYNNNNRTG 1 cut(s) 4017
Msp20I TGGCCA 2 cut(s) 2488, 3995
MspA1I CMGCKG 2 cut(s) 473, 2827
MspCI CTTAAG 2 cut(s) 478, 2042
MspI CCGG 4 cut(s) 650, 1404, 1856, 3863
MspR9I CCNGG 9 cut(s) 712, 1113, 1404, 2055, 2916, 3044, 3864, 3930, 4170
MunI CAATTG 4 cut(s) 1384, 2202, 2496, 3323
MvaI CCWGG 7 cut(s) 712, 1113, 2055, 2916, 3044, 3930, 4170
MvnI CGCG 2 cut(s) 1158, 3135
NaeI GCCGGC 1 cut(s) 1857
NciI CCSGG 2 cut(s) 1404, 3864
NcoI CCATGG 1 cut(s) 3230
NdeI CATATG 1 cut(s) 5008
NgoMIV GCCGGC 1 cut(s) 1855
NlaIV GGNNCC 5 cut(s) 6, 1627, 1849, 3435, 4174
NmeAIII GCCGAG 1 cut(s) 3461
NmuCI GTSAC 2 cut(s) 1388, 1927
NruI TCGCGA 1 cut(s) 3135
NsbI TGCGCA 1 cut(s) 1646
NsiI ATGCAT 1 cut(s) 3380
NspI RCATGY 6 cut(s) 1016, 1104, 1338, 1813, 3214, 4065
OliI CACNNNNGTG 1 cut(s) 4017
PaeR7I CTCGAG 1 cut(s) 3197
PagI TCATGA 2 cut(s) 2640, 4138
PceI AGGCCT 1 cut(s) 1091
PciI ACATGT 3 cut(s) 1012, 3210, 4061
PciSI GCTCTTC 1 cut(s) 1897
PcsI WCGNNNNNNNCGW 2 cut(s) 924, 3139
PdiI GCCGGC 1 cut(s) 1857
PdmI GAANNNNTTC 4 cut(s) 1076, 1091, 2211, 4146
PkrI GCNGC 8 cut(s) 472, 689, 2060, 2470, 3989, 4453, 4588, 5128
PleI GAGTC 6 cut(s) 1915, 2055, 2697, 3208, 3348, 3956
PpsI GAGTC 6 cut(s) 1915, 2055, 2697, 3208, 3348, 3956
Ppu21I YACGTR 2 cut(s) 890, 3961
PpuMI RGGWCCY 1 cut(s) 3881
PscI ACATGT 3 cut(s) 1012, 3210, 4061
PshAI GACNNNNGTC 1 cut(s) 4108
PshBI ATTAAT 1 cut(s) 3033
PsiI TTATAA 1 cut(s) 723
Psp124BI GAGCTC 1 cut(s) 1438
Psp1406I AACGTT 2 cut(s) 964, 2600
Psp5II RGGWCCY 1 cut(s) 3881
Psp6I CCWGG 7 cut(s) 710, 1111, 2053, 2914, 3042, 3928, 4168
PspFI CCCAGC 2 cut(s) 486, 4931
PspGI CCWGG 7 cut(s) 710, 1111, 2053, 2914, 3042, 3928, 4168
PspN4I GGNNCC 5 cut(s) 6, 1627, 1849, 3435, 4174
PspPI GGNCC 3 cut(s) 4, 3668, 3881
PspPPI RGGWCCY 1 cut(s) 3881
PspXI VCTCGAGB 1 cut(s) 3197
PsrI GAACNNNNNNTAC 2 cut(s) 1359, 1391
PstNI CAGNNNCTG 4 cut(s) 2277, 3935, 4559, 4901
PsuI RGATCY 8 cut(s) 163, 190, 343, 570, 1625, 1847, 2297, 3932
PvuII CAGCTG 1 cut(s) 2827
RruI TCGCGA 1 cut(s) 3135
RsaI GTAC 6 cut(s) 924, 2382, 2512, 2832, 3115, 3140
RsaNI GTAC 6 cut(s) 923, 2381, 2511, 2831, 3114, 3139
RseI CAYNNNNRTG 1 cut(s) 4017
SacI GAGCTC 1 cut(s) 1438
SapI GCTCTTC 1 cut(s) 1897
SatI GCNGC 8 cut(s) 471, 688, 2059, 2469, 3988, 4452, 4587, 5127
Sau96I GGNCC 3 cut(s) 4, 3668, 3881
SchI GAGTC 6 cut(s) 1915, 2056, 2698, 3209, 3349, 3957
ScrFI CCNGG 9 cut(s) 712, 1113, 1404, 2055, 2916, 3044, 3864, 3930, 4170
SduI GDGCHC 2 cut(s) 1438, 3482
Sfr274I CTCGAG 1 cut(s) 3197
SinI GGWCC 2 cut(s) 4, 3881
SlaI CTCGAG 1 cut(s) 3197
SmiMI CAYNNNNRTG 1 cut(s) 4017
SmlI CTYRAG 6 cut(s) 478, 1232, 1466, 2042, 2308, 3197
SmoI CTYRAG 6 cut(s) 478, 1232, 1466, 2042, 2308, 3197
SnaBI TACGTA 2 cut(s) 890, 3961
SseBI AGGCCT 1 cut(s) 1091
SspMI CTAG 5 cut(s) 905, 1002, 1298, 1325, 1424
SstI GAGCTC 1 cut(s) 1438
StuI AGGCCT 1 cut(s) 1091
StyD4I CCNGG 9 cut(s) 710, 1111, 1402, 2053, 2914, 3042, 3862, 3928, 4168
StyI CCWWGG 2 cut(s) 3230, 4113
TaiI ACGT 9 cut(s) 892, 967, 1275, 2425, 2539, 2603, 3076, 3804, 3963
TaqII GACCGA 1 cut(s) 2783
TatI WGTACW 3 cut(s) 922, 2380, 2510
TauI GCSGC 3 cut(s) 473, 690, 4589
TseFI GTSAC 2 cut(s) 1388, 1927
TseI GCWGC 5 cut(s) 2058, 2468, 3987, 4451, 5126
Tsp45I GTSAC 2 cut(s) 1388, 1927
TspGWI ACGGA 4 cut(s) 1592, 2249, 2400, 3935
Vha464I CTTAAG 2 cut(s) 478, 2042
VpaK11BI GGWCC 2 cut(s) 4, 3881
VspI ATTAAT 1 cut(s) 3033
XbaI TCTAGA 1 cut(s) 1324
XceI RCATGY 6 cut(s) 1016, 1104, 1338, 1813, 3214, 4065
XhoI CTCGAG 1 cut(s) 3197
XmiI GTMKAC 2 cut(s) 147, 1498
XmnI GAANNNNTTC 4 cut(s) 1076, 1091, 2211, 4146
XspI CTAG 5 cut(s) 905, 1002, 1298, 1325, 1424
Zsp2I ATGCAT 1 cut(s) 3380
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.