Rmu_sc0000252.1_g000011

resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000252.1
OG0000105
Physical Location & Seq
Forward (+)
39511 .. 43916
4406 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000252.1_g000011.1.cds

Sequence Viewer

Length: 3738 bp
atggtgatcattgaagaagcctcttcttcttcttccacccggccattgactagaaagagtatttccgtcaacaacacaataggcgagtctgattcaattccgattaggagatcgatggcgtcaacctcttctcgtcgtcgtcaatggaaatacgatgtgtttctcaatttcaggggcgaagatacccgctatggttttacaaatgatctgtatactgcactaaatcggaaaggaattctgacctttatcgatgacgcagagcttgagaaaggaaaatccattcgtcctgaacttttatctgcaatcgaggactctagatctgcgattgtcattctctcatggagatatgctgagtcgtcatggtgcttggatgaactcgtcaagattattcaatgcatgaaagacatgggccaacaagtcctccccgtcttctacaacgtggatccttctgatgtgcggcaccaaaggggatggtttgagctcaaaagggaaccggaagtagaagtaagggaacatgaagaagtttacgggaagaatcaggacagactaaatgcgtggagagctgctttgacacaggtggccaatctttctggctgggatttcaagaattatccatatcttgcaaaactaattgacgaaattgttaatcatatactaaagaagtccgtgtatacatcttcaagtgttgacaagggcttcataggaatgaattcccgcattcatgatttattaagaaattacatatgtccgcagcttggtggggtgcgttttatagggatccatggcatgcggggcgtaggtaagacaacacttgctcgagctatccatgatgaaatatgtcaggattttgaccaaacctgctttctttccaatgttagagaaatgtctaaaaacaatggcctagtttctctacaagaaaaacttctttccaaaatcctgatggcaaaaattaaaaatatagaggatgaatacacaggagctgctatgatagaaaggcggttgtgtagaataaaggtgcttgttgttattgatgatgtggatcagttggcacaattagagaaattggctggaagtcacaactggtttggtccagggagcagaattatcataaccaccacagatattcagttgttaaaggcacatgatgttgatgctacatataaggctaaagggttaaactttgatgaagcacttcaacttttgagtttgaaggcttttaagaaatgtcccccaccagaacattatttgcatctgtgctaccgtattttagggtatgctcaggggcttccgttggcggttgtggttttaggttcttttctatttggtagaagcattgatgaatgggcaagtgcaatagataggctaaagaacacgccacataaacgcattattgaggtgcttcggattagttttgatggactggatgaaaaagacagagaaatattcctacatattgcttgcttttacaaggggaaggataaggatcgtgtgacacaaatactagactgttgccagctaaaccctgtcattggtttaagtgttcttgctgatcaatgtctcataactatctccaacaacgaactgtcgatgcatgatttgctacaagaaatgggctgggaaattgttcgtgaacagtctcctaatcagccaggcaaacgtagtagattatggtctcatgaagacatcaacaatgtgctgaagagacataagggaacagattcaatccaaggcatggtaatggagtcgaatgaattacaagtggctcattggaagccagaatccttttcaaatttgtctcaacttagtcttctccatattcgtaatgtggaccttcccgaaggcctcacttgtctttctaattccttgagactcctcgaatggactgggtatcccttaagatctctcccaaaaaattttgaagcagatgaacttattgaacttaacttgtgccacagcaacattgaacagctttggaagggaacaaagaattttgacaagttgaagttcatcaaactctgccattctcaaaacattgtggagaccccagacctcacaggcgttcagaatcttgagagtttagatcttgaaggatgtgagaatttggtaagagtccatcaatcccttggatttctcaaaaagcttattgtcctgaatcttaaagactgcaaaagtctcgagagtctgccaagtagaattgaaatggaatctcttgaaacattaattctttctaactgctcaaaagttaagaagattcccgagtttgttggaaatatggaacgtttgttggtgctttgtcttgatgagactgccattgaggaactgcctgtttcaattgaacggctgactggccttgtctcattgaatctaagcaactgcagaaatcttgtatgtcttccaagcaccatcaataaattgaagtctgttgaaaatcttaatctttctggatgcttgaaactcggcaaacatcaggtaattgtggaggaggtggactgttttgaggaaactgatgtgaatagtgggtatgcaatagaaatctcatctgcccgtgatcgcataaaatatatgagaggttcaatcaaaaacggatgcgaagtagtttggggatcttcacataagttcttgccctctggattggtgcaaaaagcgaatacagagccaatgagtttccacttgcctatatctggtctctgtaatttaacatatctgaacctgagtaattgcaatcttggtgaaggagcatttcccaacaaatttggttcctttccctctttggtgaccttgaatctaagtgggaacaattttgttcgacttccttcaggcattggattgctttctaagcttgagaacttcaacttggagaattgcaagagacttcaagagttgtcagaccttccatcaaatagtatactagatttaagggcagatggttgtacttcactgaaacacttgtttgatgcatcaaatttgaagggattaaacaaatcatatttcaatttcatcaattgcttcaatctaaatggcaatcaaggatgcaataacatagcagttgaaatgctgaagacattcatgtatcagggaatctctaataagagggagacttttcaaattgtaattcctggaagtaatattcctgagtggttcatccatcagattgttgggtgttccttcagtgtatctctacctgaacatgggaatactagttcgattttgggatttgctttgtgtgctgtttttgtactccatgagcaccatcgggtggatgagctttacaaagatgaattcaagacttttaatgcaacacatcatcttgtatgttgcctgaagtgtgatggaagagaagtggaagtatatggcagacagcctgcatttcgctttagtgaagagttttgccaggttaagtcagatcacctgtggctattttatgtatctcatagtaaatactttggtatggataggcggcatacactttacggtgagcttgagttcttatttgaaaccagagggccgggtctggaggtgaaggcatgtggagtccgtctgatatatgagcacgatgagcacaatctgcaagaggtgataaaaaaaaccactcaatcaagcagaagcgtgtctccttttgatgatctatttgtttttgacagaacagttttaggggaaaccagtggcactggtagcggaatttgcatgcttgaagaaatagaggattggcttgaagaaatggaggattggctactctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC TIR

Protein Analysis

1245

Amino Acids

141.39

Weight (kDa)

6.03

Isoelectric Point (pI)

44.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000105)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g00561 FvH4_2g00570
malus_domestica MD10G1006400.v1.1 MD10G1006800.v1.1 MD10G1007300.v1.1 MD12G1125200.v1.1 MD12G1125400.v1.1
prunus_persica Prupe.2G059200_v2.0.a1 Prupe.8G005200_v2.0.a1 Prupe.8G046600_v2.0.a1
pyrus_communis pycom10g00460 pycom12g12340 pycom12g12360 pycom14g00580
rosa_chinensis RchiOBHm_Chr1g0315021 RchiOBHm_Chr1g0319431 RchiOBHm_Chr1g0319441 RchiOBHm_Chr1g0321301 RchiOBHm_Chr1g0322041 RchiOBHm_Chr1g0322381 RchiOBHm_Chr1g0322421 RchiOBHm_Chr1g0322491 RchiOBHm_Chr1g0322521 RchiOBHm_Chr1g0322531 RchiOBHm_Chr1g0322651 RchiOBHm_Chr1g0322701 RchiOBHm_Chr1g0322711 RchiOBHm_Chr1g0322741 RchiOBHm_Chr1g0322781 RchiOBHm_Chr1g0322831 RchiOBHm_Chr1g0322941 RchiOBHm_Chr1g0322961 RchiOBHm_Chr1g0323161 RchiOBHm_Chr1g0323221 RchiOBHm_Chr1g0323401 RchiOBHm_Chr1g0323411 RchiOBHm_Chr1g0323501 RchiOBHm_Chr1g0323611 RchiOBHm_Chr1g0323761 RchiOBHm_Chr1g0328941 RchiOBHm_Chr1g0328951 RchiOBHm_Chr1g0329001 RchiOBHm_Chr2g0101061 RchiOBHm_Chr5g0055671 RchiOBHm_Chr6g0244821 RchiOBHm_Chr6g0244831 RchiOBHm_Chr6g0244851 RchiOBHm_Chr6g0247291 RchiOBHm_Chr6g0247321 RchiOBHm_Chr6g0247331 RchiOBHm_Chr6g0250501 RchiOBHm_Chr6g0250511 RchiOBHm_Chr6g0250551 RchiOBHm_Chr6g0250581 RchiOBHm_Chr6g0250621 RchiOBHm_Chr6g0250681 RchiOBHm_Chr6g0250801 RchiOBHm_Chr6g0250831 RchiOBHm_Chr6g0250871 RchiOBHm_Chr6g0250911 RchiOBHm_Chr6g0250931 RchiOBHm_Chr6g0251011
rosa_laevigata RLG00000002602 RLG00000013892 RLG00000015208 RLG00000015326 RLG00000015500 RLG00000015524 RLG00000015527 RLG00000015528 RLG00000015531 RLG00000015536 RLG00000016540 RLG00000017048 RLG00000023324 RLG00000024652 RLG00000030298 RLG00000030301 RLG00000030303 RLG00000030304 RLG00000030318 RLG00000030322 RLG00000030325 RLG00000030326 RLG00000030331 RLG00000030350 RLG00000030354 RLG00000030357 RLG00000030358 RLG00000030367 RLG00000030369 RLG00000030382 RLG00000030389 RLG00000035003
rosa_multiflora Rmu_sc0000252.1_g000011 Rmu_sc0000252.1_g000020 Rmu_sc0000252.1_g000029 Rmu_sc0000276.1_g000063 Rmu_sc0000504.1_g000023 Rmu_sc0000745.1_g000032 Rmu_sc0000745.1_g000041 Rmu_sc0000749.1_g000028 Rmu_sc0000749.1_g000035 Rmu_sc0000749.1_g000041 Rmu_sc0000749.1_g000052 Rmu_sc0000804.1_g000001 Rmu_sc0001168.1_g000012 Rmu_sc0001209.1_g000011 Rmu_sc0001209.1_g000022 Rmu_sc0001209.1_g000029 Rmu_sc0001209.1_g000031 Rmu_sc0001209.1_g000032 Rmu_sc0001932.1_g000010 Rmu_sc0001932.1_g000023 Rmu_sc0001932.1_g000028 Rmu_sc0002132.1_g000015 Rmu_sc0002132.1_g000031 Rmu_sc0002132.1_g000047 Rmu_sc0002263.1_g000015 Rmu_sc0002263.1_g000024 Rmu_sc0002263.1_g000028 Rmu_sc0002263.1_g000030 Rmu_sc0002263.1_g000039 Rmu_sc0002634.1_g000017 Rmu_sc0002634.1_g000024 Rmu_sc0002634.1_g000038 Rmu_sc0003226.1_g000025 Rmu_sc0003226.1_g000083 Rmu_sc0003226.1_g000084 Rmu_sc0003413.1_g000022 Rmu_sc0003413.1_g000023 Rmu_sc0003418.1_g000011 Rmu_sc0003418.1_g000012 Rmu_sc0003743.1_g000036 Rmu_sc0004185.1_g000005 Rmu_sc0004368.1_g000015 Rmu_sc0004368.1_g000031 Rmu_sc0004368.1_g000032 Rmu_sc0004439.1_g000008 Rmu_sc0006638.1_g000017 Rmu_sc0007485.1_g000009 Rmu_sc0007698.1_g000015 Rmu_sc0009428.1_g000002 Rmu_sc0012920.1_g000010 Rmu_sc0019291.1_g000002 Rmu_sc0026821.1_g000001
rosa_roxburghii Rroxscaffold_160G00433940 Rroxscaffold_180G00433550 Rroxscaffold_1G00024620 Rroxscaffold_2G00121250 Rroxscaffold_2G00141590 Rroxscaffold_2G00146640 Rroxscaffold_2G00146660 Rroxscaffold_4G00320080 Rroxscaffold_4G00321280 Rroxscaffold_4G00326440 Rroxscaffold_4G00326450 Rroxscaffold_4G00326500 Rroxscaffold_4G00326530 Rroxscaffold_4G00326610 Rroxscaffold_4G00326620 Rroxscaffold_4G00326770 Rroxscaffold_4G00326830 Rroxscaffold_4G00326870 Rroxscaffold_4G00326930 Rroxscaffold_4G00326940 Rroxscaffold_4G00326960 Rroxscaffold_4G00326980 Rroxscaffold_4G00327010 Rroxscaffold_4G00327110 Rroxscaffold_4G00327120 Rroxscaffold_4G00327140 Rroxscaffold_4G00327190 Rroxscaffold_4G00327200 Rroxscaffold_4G00327230 Rroxscaffold_4G00327260 Rroxscaffold_4G00327270 Rroxscaffold_4G00327320 Rroxscaffold_4G00327330 Rroxscaffold_7G00198650 Rroxscaffold_7G00214100 Rroxscaffold_7G00217130 Rroxscaffold_7G00217160 Rroxscaffold_7G00217180
rosa_rugosa Rorug01G0034500 Rorug01G0035700 Rorug01G0036000 Rorug01G0036100 Rorug01G0036200 Rorug01G0036700 Rorug01G0037900 Rorug01G0038000 Rorug01G0039000.1 Rorug01G0039400 Rorug02G0096400 Rorug02G0096500 Rorug02G0096600 Rorug02G0096700 Rorug02G0096800 Rorug05G0294500 Rorug05G0497900 Rorug05G0499300 Rorug05G0524600 Rorug06G0043700 Rorug06G0044200 RorugPtG0003400.1
rosa_samantha Rh1BG033300 Rh1BG046700 Rh1BG047600 Rh1BG109300 Rh2CG149400 Rh5CG398600 Rh5CG398700 Rh6DG004400 Rh6DG004700 Rh6DG004900 Rh6DG032100 Rh6DG032400
rosa_wichuraiana Rw0G001800 Rw0G020500 Rw0G020900 Rw1G003430 Rw1G003890 Rw1G004390 Rw1G004400 Rw1G004440 Rw1G004470 Rw1G004490 Rw1G004500 Rw1G004510 Rw1G004570 Rw1G004610 Rw1G004660 Rw1G004680 Rw1G004700 Rw1G004780 Rw1G004800 Rw1G004830 Rw1G005020 Rw2G011250 Rw2G024080 Rw2G024100 Rw3G022830 Rw6G000680 Rw6G000750 Rw6G000780 Rw6G000810 Rw6G000830 Rw6G000860 Rw6G002220 Rw6G002240 Rw6G003350 Rw6G003380 Rw6G003430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 866
AccB1I GGYRCC 1 cut(s) 459
AccB7I CCANNNNNTGG 2 cut(s) 1732, 3256
AccI GTMKAC 3 cut(s) 212, 671, 2905
AciI CCGC 9 cut(s) 187, 457, 715, 749, 790, 997, 1295, 3457, 3675
AclI AACGTT 1 cut(s) 2278
AclWI GGATC 7 cut(s) 437, 450, 772, 785, 1047, 1491, 2611
AcoI YGGCCR 2 cut(s) 41, 579
AcuI CTGAAG 5 cut(s) 1718, 2799, 3077, 3151, 3341
AcyI GRCGYC 1 cut(s) 119
AfaI GTAC 2 cut(s) 2932, 3237
AfiI CCNNNNNNNGG 6 cut(s) 755, 1529, 1732, 2681, 3188, 3256
AflII CTTAAG 1 cut(s) 1894
AhlI ACTAGT 1 cut(s) 3197
AjnI CCWGG 4 cut(s) 1090, 1648, 3115, 3390
AjuI GAANNNNNNNTTGG 4 cut(s) 846, 878, 2837, 2869
AloI GAACNNNNNNTCC 2 cut(s) 3184, 3216
Alw21I GWGCWC 4 cut(s) 483, 3249, 3552, 3561
AlwI GGATC 7 cut(s) 437, 450, 772, 785, 1047, 1491, 2611
AlwNI CAGNNNCTG 1 cut(s) 980
Ama87I CYCGRG 3 cut(s) 816, 2174, 2255
AoxI GGCC 7 cut(s) 41, 409, 579, 898, 1840, 2347, 3503
ApeKI GCWGC 3 cut(s) 563, 751, 980
AseI ATTAAT 1 cut(s) 2219
Asp700I GAANNNNTTC 6 cut(s) 709, 921, 1191, 1623, 1717, 3062
AspS9I GGNCC 4 cut(s) 409, 1088, 1828, 3503
AsuC2I CCSGG 2 cut(s) 40, 3507
AsuHPI GGTGA 7 cut(s) 16, 2741, 2785, 3398, 3485, 3529, 3586
AvaI CYCGRG 3 cut(s) 816, 2174, 2255
AvaII GGWCC 2 cut(s) 1088, 1828
BalI TGGCCA 1 cut(s) 581
BamHI GGATCC 2 cut(s) 442, 777
BanI GGYRCC 1 cut(s) 459
BanII GRGCYC 1 cut(s) 483
BbsI GAAGAC 5 cut(s) 421, 1686, 1799, 2384, 3065
Bbv12I GWGCWC 4 cut(s) 483, 3249, 3552, 3561
BbvI GCAGC 3 cut(s) 550, 763, 967
BceAI ACGGC 1 cut(s) 2354
BcgI CGANNNNNNTGC 2 cut(s) 2155, 2189
BciT130I CCWGG 4 cut(s) 1092, 1650, 3117, 3392
BciVI GTATCC 1 cut(s) 1899
BclI TGATCA 2 cut(s) 6, 1549
BcnI CCSGG 2 cut(s) 40, 3507
BcuI ACTAGT 1 cut(s) 3197
BfaI CTAG 6 cut(s) 51, 315, 902, 1502, 2909, 3198
BfmI CTRYAG 1 cut(s) 2374
BfrI CTTAAG 1 cut(s) 1894
BfuAI ACCTGC 1 cut(s) 866
BfuI GTATCC 1 cut(s) 1899
BglII AGATCT 3 cut(s) 317, 1898, 2080
BisI GCNGC 5 cut(s) 458, 564, 752, 981, 3458
BlsI GCNGC 5 cut(s) 459, 565, 753, 982, 3459
Bme1390I CCNGG 6 cut(s) 40, 1092, 1650, 3117, 3392, 3507
Bme18I GGWCC 2 cut(s) 1088, 1828
BmeT110I CYCGRG 3 cut(s) 816, 2174, 2255
BmgT120I GGNCC 4 cut(s) 409, 1088, 1828, 3503
BmiI GGNNCC 5 cut(s) 444, 461, 492, 779, 2758
BmrFI CCNGG 6 cut(s) 40, 1092, 1650, 3117, 3392, 3507
BmrI ACTGGG 1 cut(s) 1893
BmsI GCATC 8 cut(s) 1141, 1258, 1578, 2435, 2576, 2944, 2966, 3020
BmuI ACTGGG 1 cut(s) 1893
BpiI GAAGAC 5 cut(s) 421, 1686, 1799, 2384, 3065
BpmI CTGGAG 1 cut(s) 3533
Bpu10I CCTNAGC 1 cut(s) 1278
BpuEI CTTGAG 5 cut(s) 284, 1885, 2090, 2861, 3500
BpuMI CCSGG 2 cut(s) 40, 3507
Bsa29I ATCGAT 2 cut(s) 113, 249
BsaBI GATNNNNATC 2 cut(s) 1038, 1482
BsaHI GRCGYC 1 cut(s) 119
BsaI GGTCTC 3 cut(s) 1677, 2033, 2690
BsaJI CCNNGG 4 cut(s) 781, 1091, 1726, 2122
BsaWI WCCGGW 1 cut(s) 493
BsaXI ACNNNNNCTCC 2 cut(s) 405, 435
Bsc4I CCNNNNNNNGG 6 cut(s) 755, 1529, 1732, 2681, 3188, 3256
Bse1I ACTGG 6 cut(s) 1085, 1425, 1888, 2350, 3660, 3673
Bse8I GATNNNNATC 2 cut(s) 1038, 1482
BseBI CCWGG 4 cut(s) 1092, 1650, 3117, 3392
BseCI ATCGAT 2 cut(s) 113, 249
BseDI CCNNGG 4 cut(s) 781, 1091, 1726, 2122
BseJI GATNNNNATC 2 cut(s) 1038, 1482
BseLI CCNNNNNNNGG 6 cut(s) 755, 1529, 1732, 2681, 3188, 3256
BseMII CTCAG 4 cut(s) 342, 1292, 2702, 3123
BseNI ACTGG 6 cut(s) 1085, 1425, 1888, 2350, 3660, 3673
BseRI GAGGAG 2 cut(s) 1862, 2495
BseXI GCAGC 3 cut(s) 550, 763, 967
BseYI CCCAGC 2 cut(s) 594, 1614
BsgI GTGCAG 1 cut(s) 201
BshFI GGCC 7 cut(s) 43, 411, 581, 900, 1842, 2349, 3505
BshNI GGYRCC 1 cut(s) 459
BshVI ATCGAT 2 cut(s) 113, 249
BsiHKAI GWGCWC 4 cut(s) 483, 3249, 3552, 3561
BsiHKCI CYCGRG 3 cut(s) 816, 2174, 2255
BsiSI CCGG 3 cut(s) 40, 494, 3506
BslFI GGGAC 1 cut(s) 1212
BslI CCNNNNNNNGG 6 cut(s) 755, 1529, 1732, 2681, 3188, 3256
BsmFI GGGAC 1 cut(s) 1212
BsmI GAATGC 1 cut(s) 717
BsnI GGCC 7 cut(s) 43, 411, 581, 900, 1842, 2349, 3505
Bso31I GGTCTC 3 cut(s) 1677, 2033, 2690
BsoBI CYCGRG 3 cut(s) 816, 2174, 2255
Bsp1286I GDGCHC 4 cut(s) 483, 3249, 3552, 3561
Bsp19I CCATGG 1 cut(s) 781
BspACI CCGC 9 cut(s) 187, 457, 715, 749, 790, 997, 1295, 3457, 3675
BspANI GGCC 7 cut(s) 43, 411, 581, 900, 1842, 2349, 3505
BspCNI CTCAG 4 cut(s) 343, 1291, 2703, 3124
BspDI ATCGAT 2 cut(s) 113, 249
BspHI TCATGA 2 cut(s) 721, 1675
BspLI GGNNCC 5 cut(s) 444, 461, 492, 779, 2758
BspMAI CTGCAG 1 cut(s) 2378
BspMI ACCTGC 1 cut(s) 866
BspPI GGATC 7 cut(s) 437, 450, 772, 785, 1047, 1491, 2611
BspT107I GGYRCC 1 cut(s) 459
BspTI CTTAAG 1 cut(s) 1894
BspTNI GGTCTC 3 cut(s) 1677, 2033, 2690
BsrI ACTGG 6 cut(s) 1085, 1425, 1888, 2350, 3660, 3673
BssECI CCNNGG 4 cut(s) 781, 1091, 1726, 2122
BssNAI GTATAC 3 cut(s) 213, 672, 2906
BssNI GRCGYC 1 cut(s) 119
BssT1I CCWWGG 3 cut(s) 781, 1726, 2122
Bst1107I GTATAC 3 cut(s) 213, 672, 2906
Bst2UI CCWGG 4 cut(s) 1092, 1650, 3117, 3392
Bst4CI ACNGT 7 cut(s) 1262, 1508, 1584, 1635, 2492, 3473, 3646
Bst6I CTCTTC 5 cut(s) 28, 133, 1694, 3328, 3375
BstACI GRCGYC 1 cut(s) 119
BstAFI CTTAAG 1 cut(s) 1894
BstAPI GCANNNNNTGC 2 cut(s) 1597, 3565
BstC8I GCNNGC 5 cut(s) 788, 1459, 1514, 3363, 3686
BstDEI CTNAG 8 cut(s) 351, 1278, 1802, 2366, 2711, 2786, 2835, 3132
BstDSI CCRYGG 1 cut(s) 781
BstEII GGTNACC 1 cut(s) 2773
BstMWI GCNNNNNNNGC 9 cut(s) 560, 792, 1597, 2836, 3224, 3556, 3565, 3672, 3681
BstNI CCWGG 4 cut(s) 1092, 1650, 3117, 3392
BstNSI RCATGY 3 cut(s) 790, 3528, 3688
BstPI GGTNACC 1 cut(s) 2773
BstSCI CCNGG 6 cut(s) 38, 1090, 1648, 3115, 3390, 3505
BstSFI CTRYAG 1 cut(s) 2374
BstV1I GCAGC 3 cut(s) 550, 763, 967
BstV2I GAAGAC 5 cut(s) 421, 1686, 1799, 2384, 3065
BstX2I RGATCY 6 cut(s) 317, 442, 777, 1898, 2080, 2603
BstYI RGATCY 6 cut(s) 317, 442, 777, 1898, 2080, 2603
BstZ17I GTATAC 3 cut(s) 213, 672, 2906
Bsu15I ATCGAT 2 cut(s) 113, 249
BsuI GTATCC 1 cut(s) 1899
BsuRI GGCC 7 cut(s) 43, 411, 581, 900, 1842, 2349, 3505
BsuTUI ATCGAT 2 cut(s) 113, 249
BtgI CCRYGG 1 cut(s) 781
BtsIMutI CAGTG 4 cut(s) 2936, 3175, 3666, 3667
BveI ACCTGC 1 cut(s) 866
Cac8I GCNNGC 5 cut(s) 788, 1459, 1514, 3363, 3686
CaiI CAGNNNCTG 1 cut(s) 980
CciI TCATGA 2 cut(s) 721, 1675
Cfr13I GGNCC 4 cut(s) 409, 1088, 1828, 3503
ClaI ATCGAT 2 cut(s) 113, 249
CseI GACGC 2 cut(s) 108, 263
Csp6I GTAC 2 cut(s) 2931, 3236
CviQI GTAC 2 cut(s) 2931, 3236
DdeI CTNAG 8 cut(s) 351, 1278, 1802, 2366, 2711, 2786, 2835, 3132
EaeI YGGCCR 2 cut(s) 41, 579
Eam1104I CTCTTC 5 cut(s) 28, 133, 1694, 3328, 3375
EarI CTCTTC 5 cut(s) 28, 133, 1694, 3328, 3375
Ecl136II GAGCTC 1 cut(s) 481
Eco130I CCWWGG 3 cut(s) 781, 1726, 2122
Eco147I AGGCCT 1 cut(s) 1842
Eco24I GRGCYC 1 cut(s) 483
Eco31I GGTCTC 3 cut(s) 1677, 2033, 2690
Eco47I GGWCC 2 cut(s) 1088, 1828
Eco53kI GAGCTC 1 cut(s) 481
Eco57I CTGAAG 5 cut(s) 1718, 2799, 3077, 3151, 3341
Eco88I CYCGRG 3 cut(s) 816, 2174, 2255
Eco91I GGTNACC 1 cut(s) 2773
EcoICRI GAGCTC 1 cut(s) 481
EcoO65I GGTNACC 1 cut(s) 2773
EcoRI GAATTC 3 cut(s) 234, 709, 3278
EcoRII CCWGG 4 cut(s) 1090, 1648, 3115, 3390
EcoT14I CCWWGG 3 cut(s) 781, 1726, 2122
EcoT22I ATGCAT 3 cut(s) 398, 1593, 2959
EcoT38I GRGCYC 1 cut(s) 483
ErhI CCWWGG 3 cut(s) 781, 1726, 2122
FalI AAGNNNNNCTT 2 cut(s) 906, 938
FaqI GGGAC 1 cut(s) 1212
FauI CCCGC 3 cut(s) 194, 722, 783
FauNDI CATATG 1 cut(s) 743
FbaI TGATCA 2 cut(s) 6, 1549
FblI GTMKAC 3 cut(s) 212, 671, 2905
Fnu4HI GCNGC 5 cut(s) 458, 564, 752, 981, 3458
FriOI GRGCYC 1 cut(s) 483
Fsp4HI GCNGC 5 cut(s) 458, 564, 752, 981, 3458
FspBI CTAG 6 cut(s) 51, 315, 902, 1502, 2909, 3198
GluI GCNGC 5 cut(s) 458, 564, 752, 981, 3458
GsaI CCCAGC 2 cut(s) 598, 1618
GsuI CTGGAG 1 cut(s) 3533
HaeIII GGCC 7 cut(s) 43, 411, 581, 900, 1842, 2349, 3505
HapII CCGG 3 cut(s) 40, 494, 3506
HgaI GACGC 2 cut(s) 108, 263
Hin1I GRCGYC 1 cut(s) 119
HincII GTYRAC 3 cut(s) 70, 123, 688
HindII GTYRAC 3 cut(s) 70, 123, 688
HindIII AAGCTT 2 cut(s) 2138, 2837
HpaII CCGG 3 cut(s) 40, 494, 3506
HphI GGTGA 7 cut(s) 16, 2741, 2785, 3398, 3485, 3529, 3586
Hpy99I CGWCG 2 cut(s) 138, 141
HpyCH4III ACNGT 7 cut(s) 1262, 1508, 1584, 1635, 2492, 3473, 3646
HpyCH4IV ACGT 3 cut(s) 438, 1657, 2278
HpyF10VI GCNNNNNNNGC 9 cut(s) 560, 792, 1597, 2836, 3224, 3556, 3565, 3672, 3681
HpyF3I CTNAG 8 cut(s) 351, 1278, 1802, 2366, 2711, 2786, 2835, 3132
HpySE526I ACGT 3 cut(s) 438, 1657, 2278
Hsp92I GRCGYC 1 cut(s) 119
Ksp22I TGATCA 2 cut(s) 6, 1549
LmnI GCTCC 3 cut(s) 977, 1095, 2735
Lsp1109I GCAGC 3 cut(s) 550, 763, 967
LweI GCATC 8 cut(s) 1141, 1258, 1578, 2435, 2576, 2944, 2966, 3020
MaeI CTAG 6 cut(s) 51, 315, 902, 1502, 2909, 3198
MaeII ACGT 3 cut(s) 438, 1657, 2278
MaeIII GTNAC 3 cut(s) 1073, 1489, 2773
MfeI CAATTG 2 cut(s) 2331, 3001
MflI RGATCY 6 cut(s) 317, 442, 777, 1898, 2080, 2603
MhlI GDGCHC 4 cut(s) 483, 3249, 3552, 3561
MlsI TGGCCA 1 cut(s) 581
MluNI TGGCCA 1 cut(s) 581
MlyI GAGTC 8 cut(s) 95, 305, 362, 1751, 1863, 2118, 2188, 3540
MmeI TCCRAC 2 cut(s) 1596, 2245
Mox20I TGGCCA 1 cut(s) 581
Mph1103I ATGCAT 3 cut(s) 398, 1593, 2959
MroXI GAANNNNTTC 6 cut(s) 709, 921, 1191, 1623, 1717, 3062
MscI TGGCCA 1 cut(s) 581
MslI CAYNNNNRTG 2 cut(s) 704, 1736
Msp20I TGGCCA 1 cut(s) 581
MspCI CTTAAG 1 cut(s) 1894
MspI CCGG 3 cut(s) 40, 494, 3506
MspR9I CCNGG 6 cut(s) 40, 1092, 1650, 3117, 3392, 3507
MunI CAATTG 2 cut(s) 2331, 3001
Mva1269I GAATGC 1 cut(s) 717
MvaI CCWGG 4 cut(s) 1092, 1650, 3117, 3392
MwoI GCNNNNNNNGC 9 cut(s) 560, 792, 1597, 2836, 3224, 3556, 3565, 3672, 3681
NciI CCSGG 2 cut(s) 40, 3507
NcoI CCATGG 1 cut(s) 781
NdeI CATATG 1 cut(s) 743
NlaIV GGNNCC 5 cut(s) 444, 461, 492, 779, 2758
NmeAIII GCCGAG 1 cut(s) 2436
NmuCI GTSAC 3 cut(s) 1073, 1489, 2773
NsiI ATGCAT 3 cut(s) 398, 1593, 2959
NspI RCATGY 3 cut(s) 790, 3528, 3688
PaeI GCATGC 2 cut(s) 790, 3688
PaeR7I CTCGAG 2 cut(s) 816, 2174
PagI TCATGA 2 cut(s) 721, 1675
PceI AGGCCT 1 cut(s) 1842
PctI GAATGC 1 cut(s) 717
PdmI GAANNNNTTC 6 cut(s) 709, 921, 1191, 1623, 1717, 3062
PflMI CCANNNNNTGG 2 cut(s) 1732, 3256
PfoI TCCNGGA 1 cut(s) 3115
PkrI GCNGC 5 cut(s) 459, 565, 753, 982, 3459
PleI GAGTC 8 cut(s) 94, 305, 361, 1750, 1863, 2117, 2187, 3539
PpsI GAGTC 8 cut(s) 94, 305, 361, 1750, 1863, 2117, 2187, 3539
PshBI ATTAAT 1 cut(s) 2219
Psp124BI GAGCTC 1 cut(s) 483
Psp1406I AACGTT 1 cut(s) 2278
Psp6I CCWGG 4 cut(s) 1090, 1648, 3115, 3390
PspEI GGTNACC 1 cut(s) 2773
PspFI CCCAGC 2 cut(s) 594, 1614
PspGI CCWGG 4 cut(s) 1090, 1648, 3115, 3390
PspN4I GGNNCC 5 cut(s) 444, 461, 492, 779, 2758
PspPI GGNCC 4 cut(s) 409, 1088, 1828, 3503
PspXI VCTCGAGB 1 cut(s) 816
PstI CTGCAG 1 cut(s) 2378
PstNI CAGNNNCTG 1 cut(s) 980
PsuI RGATCY 6 cut(s) 317, 442, 777, 1898, 2080, 2603
RsaI GTAC 2 cut(s) 2932, 3237
RsaNI GTAC 2 cut(s) 2931, 3236
RseI CAYNNNNRTG 2 cut(s) 704, 1736
SacI GAGCTC 1 cut(s) 483
SatI GCNGC 5 cut(s) 458, 564, 752, 981, 3458
Sau96I GGNCC 4 cut(s) 409, 1088, 1828, 3503
SchI GAGTC 8 cut(s) 95, 305, 362, 1751, 1863, 2118, 2188, 3540
ScrFI CCNGG 6 cut(s) 40, 1092, 1650, 3117, 3392, 3507
SduI GDGCHC 4 cut(s) 483, 3249, 3552, 3561
SfaNI GCATC 8 cut(s) 1141, 1258, 1578, 2435, 2576, 2944, 2966, 3020
SfcI CTRYAG 1 cut(s) 2374
Sfr274I CTCGAG 2 cut(s) 816, 2174
SinI GGWCC 2 cut(s) 1088, 1828
SlaI CTCGAG 2 cut(s) 816, 2174
SmiMI CAYNNNNRTG 2 cut(s) 704, 1736
SmlI CTYRAG 8 cut(s) 263, 816, 1864, 1894, 2069, 2174, 2840, 3479
SmoI CTYRAG 8 cut(s) 263, 816, 1864, 1894, 2069, 2174, 2840, 3479
SpeI ACTAGT 1 cut(s) 3197
SphI GCATGC 2 cut(s) 790, 3688
SseBI AGGCCT 1 cut(s) 1842
SsiI CCGC 9 cut(s) 187, 457, 715, 749, 790, 997, 1295, 3457, 3675
SspI AATATT 2 cut(s) 1443, 3127
SspMI CTAG 6 cut(s) 51, 315, 902, 1502, 2909, 3198
SstI GAGCTC 1 cut(s) 483
StuI AGGCCT 1 cut(s) 1842
StyD4I CCNGG 6 cut(s) 38, 1090, 1648, 3115, 3390, 3505
StyI CCWWGG 3 cut(s) 781, 1726, 2122
TaaI ACNGT 7 cut(s) 1262, 1508, 1584, 1635, 2492, 3473, 3646
TaiI ACGT 3 cut(s) 441, 1660, 2281
TatI WGTACW 2 cut(s) 2930, 3235
TauI GCSGC 2 cut(s) 460, 3460
TscAI CASTG 4 cut(s) 2943, 3175, 3667, 3673
TseFI GTSAC 3 cut(s) 1073, 1489, 2773
TseI GCWGC 3 cut(s) 563, 751, 980
Tsp45I GTSAC 3 cut(s) 1073, 1489, 2773
TspGWI ACGGA 5 cut(s) 55, 655, 1278, 2598, 3524
TspRI CASTG 4 cut(s) 2943, 3175, 3667, 3673
Van91I CCANNNNNTGG 2 cut(s) 1732, 3256
Vha464I CTTAAG 1 cut(s) 1894
VpaK11BI GGWCC 2 cut(s) 1088, 1828
VspI ATTAAT 1 cut(s) 2219
XbaI TCTAGA 1 cut(s) 314
XceI RCATGY 3 cut(s) 790, 3528, 3688
XcmI CCANNNNNNNNNTGG 3 cut(s) 937, 2120, 3152
XhoI CTCGAG 2 cut(s) 816, 2174
XmiI GTMKAC 3 cut(s) 212, 671, 2905
XmnI GAANNNNTTC 6 cut(s) 709, 921, 1191, 1623, 1717, 3062
XspI CTAG 6 cut(s) 51, 315, 902, 1502, 2909, 3198
Zsp2I ATGCAT 3 cut(s) 398, 1593, 2959
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.