Rmu_sc0002263.1_g000039

resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002263.1
OG0000105
Physical Location & Seq
Reverse (-)
169499 .. 173849
4351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002263.1_g000039.1.cds

Sequence Viewer

Length: 3627 bp
atggcgtcaacctcttctcgtcgtcaatggaaatacgatgtctttctcaatttcaggggggaaacccgctatacttttacccatcatctgtatgctgcactaaatcagaaaggaattctcacctttatggatgaccgagagcttgagaaaggaaaatccatacggcctgaacttttagctgcaattgaggagtctagatctgcgattgtcattctctcagagaactatgcttcttcgtcatggtgcttggatgaactggtcaagattattcaatgcatgaaagagcagggccaacaagtcctccccgtcttcttgtgggtggatccttctgatgtgcggcaccaaaggggaaggtttcagctcaaagtaagggaacacaaagtaggtgtggaagtaagggaacatgaagaggtttatgggaagaatgaggacagactaaatgcgtggagagctgctttgactgagatcgccaatctttctggctggcatttcaagaattatccatatgattcaaaaataattgacgaaattgttaatgatatactaaagaagtccgtggatacatcttcaagtgttgacgagggcttcatcggaatggattcccgcattgatgatttaataagcaattacatatgtccacagcttcgtggggtgcgttttatagggatccatggcatgcggggcataggtaagacaacacttgctcgagctatccatgatcaaatttgtcgggattttgaccgaacctgctttctttccaatgttagagaaatgtctaaaaacaatggcctagtttctctgcaagaaaaacttctttccagaatcctgatggcaaaaattgaaaatatagaggatgaatacgcaggagctgctatgataaaaaggcgggcgtgtagaataaaggtgcttgttgttattgatgatgtggatcagttgactcaattagaaaaattggctgcaagtcgcaactggtttggtccggggagtagaattgtcataaccaccacagatgttcagttgttaaaggcacatgatgttgatgctacatacaaggctaacgtgttaaactgtgatgaagcacttcaacttttgagtttgaaggcttttaagaaatttcccccaccagaagattatttgcatctgtgctaccatattatagggtatgctaaggggcttccgttggctctcgtggttttaggttcttttctatttggtagaagaactgatgaatgggcaagtgcaatagataggctaaagaacacgccagataaacgcattattgatgtgcttcggattagttttgatggactggatgaaaaagacaaagaaatattcctacatattgcttgcttttacaaggggaaggataaggatagtgtgacacaaatactagactattgccagctaaaccctgtcattggtttgagtgttcttgctgatagatctctcataactatctccaacaacgaactatggatgcatgatttgctacaagaactgggccgggaaattgttcgtgaacagtctcctaaagagccaggcaaacgtagtagattatggtctcatgaagacatcaacaatgtgctgaagaaaaataagggaacagattcaatccaaggcatggtaatggagttgactaaattacaagtggctcattggaagccagaagccttttcaaatttgtctcaacttagtcttctccatattcataatgtggaccttcccaaaggcctcacttgtctttctaattccttaagactcctcgaatggactgggtatcccttaagatctctcccaaaaaattttgaagcagatgaacttattgaacttaacttgtgccgcagcaacattaaaaagctttggaagggaacaaagaattttgacaacttgaagttcatcaaactctgccattctcaaaacattgtggagaccccagacctcgcaggtgttcagaatcttgagactttagatcttgaaggatgttctcatttggtaagaatccatcaatcccttggatttctcaaaaagcttattgtcctgaatcttaaagactgcgaaagtctccagagtctgccaagtataatggaaatggaatctcttgaaacattaattctttctaactgctcaaaagttaagaagattcccgagtttgttggaaatatggaacgtttgtcggtgctttatcttgatgagactgccgttgaggaactgcctgtttcaattgaacggctgactggccttgtgacattgaatctaagcaactgcagaaatcttgtttgtcttccaagcagcatcaataaattgaagtctgttgaaaatcttaatctttctggatgcttgaaactcggcaaacatcaggtaaatgtgggggtgatggactgttttgaggaaactgatgtgaatagtgggtctgcaattgaaatgtcatctacccatgatcgcagaaaatatgtgagaggttcaatctttcttggatgcaaagtagtttggcgatctttaaaaaaggtcttgccttctggattggtgcaaaaagtgaatacagagccaaagagtttccacttgcctatatcacaaaaagtgaatacagagccaatgagtttccgcttgcctatatctggtctgcgtaacttaacatatctgaacctgagtaattgcaatcttggtgaaggagcatttgccaacgaatttggttactttccctctttggtgaccttgaatctaagtgggaacagttttgttcgtcttccttcaggcattggattgctttctaagcttgagaactttaacttggagaattgcaagagacttcaagagttgtcagaccttccatcaaatagtatactagatttaagggcagatggttgtacttcactgaaatacttgtttgatgcatcaaatttgaatagattaagcaaatcatatttcaatttcatcaattgcttcaatctaaatggcaatcaagggtgcaataacatagcattcgaaatgctgaagacattcatgtatcagggaatctctaataacagggaaacttttcaaattgtaattcctggaagtaatattcctgagtggttcagccatcagagtgttgggtgttccgtaagtgtatctgtacctgcacattggaataacagtcgggttttgggatttgctctgtgtgctgtttttgcactccatgagcaccatcgggtggataagctttatatagatgaattcaagacttttaatgcaacacatcatcttgtatgttgcctgaagctcgatggaagagaattggaagtatatggcagacagcctgcatttcgctttagtgaagaattttgcaaggttaagtcggatcacctgtggctattctatgtatctcgtgataaatactttggtacaaagtggtggcataacagttacagtcagtttgagttcttatttgaaaccagagggccaggtctgaaggtgaaggagtgtggagtccgtctgatatatgagcaagatgtgcaagagttgaaccaaacaaccactcaatcaagcagtgggatgataagggaggatatattgattggttttgacattccagttgcaggggaaacctgtggcagtggcagcagaacttgcacgcttgaagaattatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC TIR

Protein Analysis

1208

Amino Acids

137.35

Weight (kDa)

7.15

Isoelectric Point (pI)

41.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000105)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g00561 FvH4_2g00570
malus_domestica MD10G1006400.v1.1 MD10G1006800.v1.1 MD10G1007300.v1.1 MD12G1125200.v1.1 MD12G1125400.v1.1
prunus_persica Prupe.2G059200_v2.0.a1 Prupe.8G005200_v2.0.a1 Prupe.8G046600_v2.0.a1
pyrus_communis pycom10g00460 pycom12g12340 pycom12g12360 pycom14g00580
rosa_chinensis RchiOBHm_Chr1g0315021 RchiOBHm_Chr1g0319431 RchiOBHm_Chr1g0319441 RchiOBHm_Chr1g0321301 RchiOBHm_Chr1g0322041 RchiOBHm_Chr1g0322381 RchiOBHm_Chr1g0322421 RchiOBHm_Chr1g0322491 RchiOBHm_Chr1g0322521 RchiOBHm_Chr1g0322531 RchiOBHm_Chr1g0322651 RchiOBHm_Chr1g0322701 RchiOBHm_Chr1g0322711 RchiOBHm_Chr1g0322741 RchiOBHm_Chr1g0322781 RchiOBHm_Chr1g0322831 RchiOBHm_Chr1g0322941 RchiOBHm_Chr1g0322961 RchiOBHm_Chr1g0323161 RchiOBHm_Chr1g0323221 RchiOBHm_Chr1g0323401 RchiOBHm_Chr1g0323411 RchiOBHm_Chr1g0323501 RchiOBHm_Chr1g0323611 RchiOBHm_Chr1g0323761 RchiOBHm_Chr1g0328941 RchiOBHm_Chr1g0328951 RchiOBHm_Chr1g0329001 RchiOBHm_Chr2g0101061 RchiOBHm_Chr5g0055671 RchiOBHm_Chr6g0244821 RchiOBHm_Chr6g0244831 RchiOBHm_Chr6g0244851 RchiOBHm_Chr6g0247291 RchiOBHm_Chr6g0247321 RchiOBHm_Chr6g0247331 RchiOBHm_Chr6g0250501 RchiOBHm_Chr6g0250511 RchiOBHm_Chr6g0250551 RchiOBHm_Chr6g0250581 RchiOBHm_Chr6g0250621 RchiOBHm_Chr6g0250681 RchiOBHm_Chr6g0250801 RchiOBHm_Chr6g0250831 RchiOBHm_Chr6g0250871 RchiOBHm_Chr6g0250911 RchiOBHm_Chr6g0250931 RchiOBHm_Chr6g0251011
rosa_laevigata RLG00000002602 RLG00000013892 RLG00000015208 RLG00000015326 RLG00000015500 RLG00000015524 RLG00000015527 RLG00000015528 RLG00000015531 RLG00000015536 RLG00000016540 RLG00000017048 RLG00000023324 RLG00000024652 RLG00000030298 RLG00000030301 RLG00000030303 RLG00000030304 RLG00000030318 RLG00000030322 RLG00000030325 RLG00000030326 RLG00000030331 RLG00000030350 RLG00000030354 RLG00000030357 RLG00000030358 RLG00000030367 RLG00000030369 RLG00000030382 RLG00000030389 RLG00000035003
rosa_multiflora Rmu_sc0000252.1_g000011 Rmu_sc0000252.1_g000020 Rmu_sc0000252.1_g000029 Rmu_sc0000276.1_g000063 Rmu_sc0000504.1_g000023 Rmu_sc0000745.1_g000032 Rmu_sc0000745.1_g000041 Rmu_sc0000749.1_g000028 Rmu_sc0000749.1_g000035 Rmu_sc0000749.1_g000041 Rmu_sc0000749.1_g000052 Rmu_sc0000804.1_g000001 Rmu_sc0001168.1_g000012 Rmu_sc0001209.1_g000011 Rmu_sc0001209.1_g000022 Rmu_sc0001209.1_g000029 Rmu_sc0001209.1_g000031 Rmu_sc0001209.1_g000032 Rmu_sc0001932.1_g000010 Rmu_sc0001932.1_g000023 Rmu_sc0001932.1_g000028 Rmu_sc0002132.1_g000015 Rmu_sc0002132.1_g000031 Rmu_sc0002132.1_g000047 Rmu_sc0002263.1_g000015 Rmu_sc0002263.1_g000024 Rmu_sc0002263.1_g000028 Rmu_sc0002263.1_g000030 Rmu_sc0002263.1_g000039 Rmu_sc0002634.1_g000017 Rmu_sc0002634.1_g000024 Rmu_sc0002634.1_g000038 Rmu_sc0003226.1_g000025 Rmu_sc0003226.1_g000083 Rmu_sc0003226.1_g000084 Rmu_sc0003413.1_g000022 Rmu_sc0003413.1_g000023 Rmu_sc0003418.1_g000011 Rmu_sc0003418.1_g000012 Rmu_sc0003743.1_g000036 Rmu_sc0004185.1_g000005 Rmu_sc0004368.1_g000015 Rmu_sc0004368.1_g000031 Rmu_sc0004368.1_g000032 Rmu_sc0004439.1_g000008 Rmu_sc0006638.1_g000017 Rmu_sc0007485.1_g000009 Rmu_sc0007698.1_g000015 Rmu_sc0009428.1_g000002 Rmu_sc0012920.1_g000010 Rmu_sc0019291.1_g000002 Rmu_sc0026821.1_g000001
rosa_roxburghii Rroxscaffold_160G00433940 Rroxscaffold_180G00433550 Rroxscaffold_1G00024620 Rroxscaffold_2G00121250 Rroxscaffold_2G00141590 Rroxscaffold_2G00146640 Rroxscaffold_2G00146660 Rroxscaffold_4G00320080 Rroxscaffold_4G00321280 Rroxscaffold_4G00326440 Rroxscaffold_4G00326450 Rroxscaffold_4G00326500 Rroxscaffold_4G00326530 Rroxscaffold_4G00326610 Rroxscaffold_4G00326620 Rroxscaffold_4G00326770 Rroxscaffold_4G00326830 Rroxscaffold_4G00326870 Rroxscaffold_4G00326930 Rroxscaffold_4G00326940 Rroxscaffold_4G00326960 Rroxscaffold_4G00326980 Rroxscaffold_4G00327010 Rroxscaffold_4G00327110 Rroxscaffold_4G00327120 Rroxscaffold_4G00327140 Rroxscaffold_4G00327190 Rroxscaffold_4G00327200 Rroxscaffold_4G00327230 Rroxscaffold_4G00327260 Rroxscaffold_4G00327270 Rroxscaffold_4G00327320 Rroxscaffold_4G00327330 Rroxscaffold_7G00198650 Rroxscaffold_7G00214100 Rroxscaffold_7G00217130 Rroxscaffold_7G00217160 Rroxscaffold_7G00217180
rosa_rugosa Rorug01G0034500 Rorug01G0035700 Rorug01G0036000 Rorug01G0036100 Rorug01G0036200 Rorug01G0036700 Rorug01G0037900 Rorug01G0038000 Rorug01G0039000.1 Rorug01G0039400 Rorug02G0096400 Rorug02G0096500 Rorug02G0096600 Rorug02G0096700 Rorug02G0096800 Rorug05G0294500 Rorug05G0497900 Rorug05G0499300 Rorug05G0524600 Rorug06G0043700 Rorug06G0044200 RorugPtG0003400.1
rosa_samantha Rh1BG033300 Rh1BG046700 Rh1BG047600 Rh1BG109300 Rh2CG149400 Rh5CG398600 Rh5CG398700 Rh6DG004400 Rh6DG004700 Rh6DG004900 Rh6DG032100 Rh6DG032400
rosa_wichuraiana Rw0G001800 Rw0G020500 Rw0G020900 Rw1G003430 Rw1G003890 Rw1G004390 Rw1G004400 Rw1G004440 Rw1G004470 Rw1G004490 Rw1G004500 Rw1G004510 Rw1G004570 Rw1G004610 Rw1G004660 Rw1G004680 Rw1G004700 Rw1G004780 Rw1G004800 Rw1G004830 Rw1G005020 Rw2G011250 Rw2G024080 Rw2G024100 Rw3G022830 Rw6G000680 Rw6G000750 Rw6G000780 Rw6G000810 Rw6G000830 Rw6G000860 Rw6G002220 Rw6G002240 Rw6G003350 Rw6G003380 Rw6G003430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 1934
Acc36I ACCTGC 3 cut(s) 755, 1934, 3124
AccB1I GGYRCC 1 cut(s) 339
AccB7I CCANNNNNTGG 2 cut(s) 1621, 3190
AccI GTMKAC 1 cut(s) 2839
AciI CCGC 7 cut(s) 67, 337, 604, 679, 886, 1840, 2602
AclI AACGTT 1 cut(s) 2167
AclWI GGATC 6 cut(s) 317, 330, 661, 674, 936, 3345
AcuI CTGAAG 5 cut(s) 1607, 2733, 3011, 3275, 3467
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 3 cut(s) 2866, 3114, 3382
AfiI CCNNNNNNNGG 5 cut(s) 1418, 1621, 2615, 3190, 3575
AflII CTTAAG 2 cut(s) 1753, 1783
AflIII ACRYGT 1 cut(s) 1059
AjnI CCWGG 3 cut(s) 1537, 3049, 3439
AjuI GAANNNNNNNTTGG 2 cut(s) 2771, 2803
Alw21I GWGCWC 1 cut(s) 3183
Alw26I GTCTC 8 cut(s) 1530, 1566, 1689, 1922, 1955, 2066, 2186, 2797
AlwI GGATC 6 cut(s) 317, 330, 661, 674, 936, 3345
AlwNI CAGNNNCTG 2 cut(s) 869, 2071
Ama87I CYCGRG 2 cut(s) 705, 2144
AoxI GGCC 7 cut(s) 164, 289, 787, 1501, 1729, 2236, 3437
ApeKI GCWGC 8 cut(s) 95, 179, 452, 869, 956, 1842, 2289, 3597
AseI ATTAAT 1 cut(s) 2108
Asp700I GAANNNNTTC 7 cut(s) 598, 810, 1080, 1512, 1606, 2996, 3033
AspS9I GGNCC 5 cut(s) 289, 977, 1501, 1717, 3437
AsuC2I CCSGG 2 cut(s) 981, 1505
AsuHPI GGTGA 6 cut(s) 112, 2383, 2675, 2719, 3332, 3463
AsuII TTCGAA 1 cut(s) 2982
AvaI CYCGRG 2 cut(s) 705, 2144
AvaII GGWCC 2 cut(s) 977, 1717
BamHI GGATCC 2 cut(s) 322, 666
BanI GGYRCC 1 cut(s) 339
BauI CACGAG 2 cut(s) 1187, 3363
BbsI GAAGAC 6 cut(s) 301, 1575, 1688, 2273, 2735, 2999
Bbv12I GWGCWC 1 cut(s) 3183
BbvI GCAGC 8 cut(s) 82, 166, 439, 856, 943, 1854, 2301, 3609
BceAI ACGGC 3 cut(s) 179, 2183, 2243
BciT130I CCWGG 3 cut(s) 1539, 3051, 3441
BciVI GTATCC 2 cut(s) 553, 1788
BclI TGATCA 1 cut(s) 718
BcnI CCSGG 2 cut(s) 981, 1505
BcoDI GTCTC 8 cut(s) 1530, 1566, 1689, 1922, 1955, 2066, 2186, 2797
BfaI CTAG 4 cut(s) 195, 791, 1391, 2843
BfmI CTRYAG 1 cut(s) 2263
BfrI CTTAAG 2 cut(s) 1753, 1783
BfuAI ACCTGC 3 cut(s) 755, 1934, 3124
BfuI GTATCC 2 cut(s) 553, 1788
BglII AGATCT 4 cut(s) 197, 1442, 1787, 1969
Bme1390I CCNGG 5 cut(s) 981, 1505, 1539, 3051, 3441
Bme18I GGWCC 2 cut(s) 977, 1717
BmeT110I CYCGRG 2 cut(s) 705, 2144
BmgT120I GGNCC 5 cut(s) 289, 977, 1501, 1717, 3437
BmiI GGNNCC 3 cut(s) 324, 341, 668
BmrFI CCNGG 5 cut(s) 981, 1505, 1539, 3051, 3441
BmrI ACTGGG 2 cut(s) 1508, 1782
BmsI GCATC 8 cut(s) 1030, 1147, 1467, 2301, 2324, 2465, 2878, 2900
BmuI ACTGGG 2 cut(s) 1508, 1782
BpiI GAAGAC 6 cut(s) 301, 1575, 1688, 2273, 2735, 2999
BpmI CTGGAG 1 cut(s) 2048
Bpu10I CCTNAGC 1 cut(s) 1167
Bpu14I TTCGAA 1 cut(s) 2982
BpuEI CTTGAG 3 cut(s) 164, 1979, 2795
BpuMI CCSGG 2 cut(s) 981, 1505
BsaBI GATNNNNATC 1 cut(s) 927
BsaHI GRCGYC 1 cut(s) 5
BsaI GGTCTC 2 cut(s) 1566, 1922
BsaJI CCNNGG 5 cut(s) 555, 670, 980, 1615, 2011
BsaXI ACNNNNNCTCC 2 cut(s) 285, 315
Bsc4I CCNNNNNNNGG 5 cut(s) 1418, 1621, 2615, 3190, 3575
Bse1I ACTGG 7 cut(s) 261, 974, 1314, 1503, 1777, 2239, 3569
Bse8I GATNNNNATC 1 cut(s) 927
BseBI CCWGG 3 cut(s) 1539, 3051, 3441
BseDI CCNNGG 5 cut(s) 555, 670, 980, 1615, 2011
BseGI GGATG 9 cut(s) 136, 256, 859, 1318, 1482, 1985, 2339, 2480, 3537
BseJI GATNNNNATC 1 cut(s) 927
BseLI CCNNNNNNNGG 5 cut(s) 1418, 1621, 2615, 3190, 3575
BseMII CTCAG 4 cut(s) 231, 453, 2636, 3057
BseNI ACTGG 7 cut(s) 261, 974, 1314, 1503, 1777, 2239, 3569
BseRI GAGGAG 2 cut(s) 203, 1751
BseXI GCAGC 8 cut(s) 82, 166, 439, 856, 943, 1854, 2301, 3609
BsgI GTGCAG 2 cut(s) 81, 3102
BshFI GGCC 7 cut(s) 166, 291, 789, 1503, 1731, 2238, 3439
BshNI GGYRCC 1 cut(s) 339
BsiHKAI GWGCWC 1 cut(s) 3183
BsiHKCI CYCGRG 2 cut(s) 705, 2144
BsiSI CCGG 2 cut(s) 980, 1504
BslI CCNNNNNNNGG 5 cut(s) 1418, 1621, 2615, 3190, 3575
BsmAI GTCTC 8 cut(s) 1530, 1566, 1689, 1922, 1955, 2066, 2186, 2797
BsmI GAATGC 1 cut(s) 2978
BsnI GGCC 7 cut(s) 166, 291, 789, 1503, 1731, 2238, 3439
Bso31I GGTCTC 2 cut(s) 1566, 1922
BsoBI CYCGRG 2 cut(s) 705, 2144
Bsp119I TTCGAA 1 cut(s) 2982
Bsp1286I GDGCHC 1 cut(s) 3183
Bsp19I CCATGG 1 cut(s) 670
BspACI CCGC 7 cut(s) 67, 337, 604, 679, 886, 1840, 2602
BspANI GGCC 7 cut(s) 166, 291, 789, 1503, 1731, 2238, 3439
BspCNI CTCAG 4 cut(s) 230, 454, 2637, 3058
BspHI TCATGA 1 cut(s) 1564
BspLI GGNNCC 3 cut(s) 324, 341, 668
BspMAI CTGCAG 1 cut(s) 2267
BspMI ACCTGC 3 cut(s) 755, 1934, 3124
BspPI GGATC 6 cut(s) 317, 330, 661, 674, 936, 3345
BspT104I TTCGAA 1 cut(s) 2982
BspT107I GGYRCC 1 cut(s) 339
BspTI CTTAAG 2 cut(s) 1753, 1783
BspTNI GGTCTC 2 cut(s) 1566, 1922
BsrI ACTGG 7 cut(s) 261, 974, 1314, 1503, 1777, 2239, 3569
BssECI CCNNGG 5 cut(s) 555, 670, 980, 1615, 2011
BssNAI GTATAC 1 cut(s) 2840
BssNI GRCGYC 1 cut(s) 5
BssSI CACGAG 2 cut(s) 1187, 3363
BssT1I CCWWGG 3 cut(s) 670, 1615, 2011
Bst1107I GTATAC 1 cut(s) 2840
Bst2BI CACGAG 2 cut(s) 1187, 3363
Bst2UI CCWGG 3 cut(s) 1539, 3051, 3441
Bst4CI ACNGT 7 cut(s) 1070, 1524, 2381, 2732, 3134, 3401, 3407
Bst6I CTCTTC 3 cut(s) 19, 402, 3262
BstACI GRCGYC 1 cut(s) 5
BstAFI CTTAAG 2 cut(s) 1753, 1783
BstAPI GCANNNNNTGC 4 cut(s) 869, 1486, 3490, 3606
BstBI TTCGAA 1 cut(s) 2982
BstC8I GCNNGC 8 cut(s) 485, 677, 888, 1348, 1403, 2606, 3297, 3611
BstDEI CTNAG 9 cut(s) 217, 462, 1167, 1691, 2255, 2645, 2720, 2769, 3066
BstDSI CCRYGG 2 cut(s) 555, 670
BstEII GGTNACC 1 cut(s) 2707
BstF5I GGATG 9 cut(s) 136, 256, 859, 1318, 1482, 1985, 2339, 2480, 3537
BstMAI GTCTC 8 cut(s) 1530, 1566, 1689, 1922, 1955, 2066, 2186, 2797
BstNI CCWGG 3 cut(s) 1539, 3051, 3441
BstNSI RCATGY 1 cut(s) 679
BstPI GGTNACC 1 cut(s) 2707
BstSCI CCNGG 5 cut(s) 979, 1503, 1537, 3049, 3439
BstSFI CTRYAG 1 cut(s) 2263
BstV1I GCAGC 8 cut(s) 82, 166, 439, 856, 943, 1854, 2301, 3609
BstV2I GAAGAC 6 cut(s) 301, 1575, 1688, 2273, 2735, 2999
BstX2I RGATCY 6 cut(s) 197, 322, 666, 1442, 1787, 1969
BstYI RGATCY 6 cut(s) 197, 322, 666, 1442, 1787, 1969
BstZ17I GTATAC 1 cut(s) 2840
BsuI GTATCC 2 cut(s) 553, 1788
BsuRI GGCC 7 cut(s) 166, 291, 789, 1503, 1731, 2238, 3439
BtgI CCRYGG 2 cut(s) 555, 670
BtsCI GGATG 9 cut(s) 136, 256, 859, 1318, 1482, 1985, 2339, 2480, 3537
BtsI GCAGTG 2 cut(s) 3532, 3598
BtsIMutI CAGTG 3 cut(s) 2870, 3532, 3598
BveI ACCTGC 3 cut(s) 755, 1934, 3124
Cac8I GCNNGC 8 cut(s) 485, 677, 888, 1348, 1403, 2606, 3297, 3611
CaiI CAGNNNCTG 2 cut(s) 869, 2071
CciI TCATGA 1 cut(s) 1564
Cfr13I GGNCC 5 cut(s) 289, 977, 1501, 1717, 3437
Csp6I GTAC 3 cut(s) 2865, 3113, 3381
CviQI GTAC 3 cut(s) 2865, 3113, 3381
DdeI CTNAG 9 cut(s) 217, 462, 1167, 1691, 2255, 2645, 2720, 2769, 3066
DraI TTTAAA 1 cut(s) 2499
Eam1104I CTCTTC 3 cut(s) 19, 402, 3262
EarI CTCTTC 3 cut(s) 19, 402, 3262
Eco130I CCWWGG 3 cut(s) 670, 1615, 2011
Eco147I AGGCCT 1 cut(s) 1731
Eco31I GGTCTC 2 cut(s) 1566, 1922
Eco47I GGWCC 2 cut(s) 977, 1717
Eco57I CTGAAG 5 cut(s) 1607, 2733, 3011, 3275, 3467
Eco88I CYCGRG 2 cut(s) 705, 2144
Eco91I GGTNACC 1 cut(s) 2707
EcoO65I GGTNACC 1 cut(s) 2707
EcoRI GAATTC 2 cut(s) 114, 3212
EcoRII CCWGG 3 cut(s) 1537, 3049, 3439
EcoT14I CCWWGG 3 cut(s) 670, 1615, 2011
EcoT22I ATGCAT 3 cut(s) 278, 1482, 2893
ErhI CCWWGG 3 cut(s) 670, 1615, 2011
FalI AAGNNNNNCTT 2 cut(s) 795, 827
FauI CCCGC 4 cut(s) 74, 611, 672, 879
FauNDI CATATG 2 cut(s) 505, 632
FbaI TGATCA 1 cut(s) 718
FblI GTMKAC 1 cut(s) 2839
FokI GGATG 9 cut(s) 143, 263, 866, 1325, 1489, 1992, 2346, 2487, 3544
FspBI CTAG 4 cut(s) 195, 791, 1391, 2843
GsuI CTGGAG 1 cut(s) 2048
HaeIII GGCC 7 cut(s) 166, 291, 789, 1503, 1731, 2238, 3439
HapII CCGG 2 cut(s) 980, 1504
Hin1I GRCGYC 1 cut(s) 5
HincII GTYRAC 4 cut(s) 9, 577, 936, 1635
HindII GTYRAC 4 cut(s) 9, 577, 936, 1635
HindIII AAGCTT 4 cut(s) 1856, 2027, 2771, 3197
HpaII CCGG 2 cut(s) 980, 1504
HphI GGTGA 6 cut(s) 112, 2383, 2675, 2719, 3332, 3463
Hpy166II GTNNAC 8 cut(s) 9, 577, 638, 936, 1520, 1635, 1717, 2840
Hpy8I GTNNAC 8 cut(s) 9, 577, 638, 936, 1520, 1635, 1717, 2840
Hpy99I CGWCG 1 cut(s) 24
HpyCH4III ACNGT 7 cut(s) 1070, 1524, 2381, 2732, 3134, 3401, 3407
HpyCH4IV ACGT 3 cut(s) 1059, 1546, 2167
HpyF3I CTNAG 9 cut(s) 217, 462, 1167, 1691, 2255, 2645, 2720, 2769, 3066
HpySE526I ACGT 3 cut(s) 1059, 1546, 2167
Hsp92I GRCGYC 1 cut(s) 5
Ksp22I TGATCA 1 cut(s) 718
LmnI GCTCC 2 cut(s) 866, 2669
Lsp1109I GCAGC 8 cut(s) 82, 166, 439, 856, 943, 1854, 2301, 3609
LweI GCATC 8 cut(s) 1030, 1147, 1467, 2301, 2324, 2465, 2878, 2900
MaeI CTAG 4 cut(s) 195, 791, 1391, 2843
MaeII ACGT 3 cut(s) 1059, 1546, 2167
MaeIII GTNAC 6 cut(s) 1378, 2242, 2624, 2690, 2707, 3401
MfeI CAATTG 4 cut(s) 183, 2220, 2415, 2935
MflI RGATCY 6 cut(s) 197, 322, 666, 1442, 1787, 1969
MhlI GDGCHC 1 cut(s) 3183
MlyI GAGTC 5 cut(s) 200, 931, 1752, 2077, 3474
MmeI TCCRAC 3 cut(s) 1485, 2134, 3315
Mph1103I ATGCAT 3 cut(s) 278, 1482, 2893
MroXI GAANNNNTTC 7 cut(s) 598, 810, 1080, 1512, 1606, 2996, 3033
MslI CAYNNNNRTG 5 cut(s) 90, 125, 593, 1625, 3084
MspCI CTTAAG 2 cut(s) 1753, 1783
MspI CCGG 2 cut(s) 980, 1504
MspR9I CCNGG 5 cut(s) 981, 1505, 1539, 3051, 3441
MunI CAATTG 4 cut(s) 183, 2220, 2415, 2935
Mva1269I GAATGC 1 cut(s) 2978
MvaI CCWGG 3 cut(s) 1539, 3051, 3441
NciI CCSGG 2 cut(s) 981, 1505
NcoI CCATGG 1 cut(s) 670
NdeI CATATG 2 cut(s) 505, 632
NlaIV GGNNCC 3 cut(s) 324, 341, 668
NmeAIII GCCGAG 1 cut(s) 2325
NmuCI GTSAC 3 cut(s) 1378, 2242, 2707
NsiI ATGCAT 3 cut(s) 278, 1482, 2893
NspI RCATGY 1 cut(s) 679
NspV TTCGAA 1 cut(s) 2982
PaeI GCATGC 1 cut(s) 679
PaeR7I CTCGAG 1 cut(s) 705
PagI TCATGA 1 cut(s) 1564
PaqCI CACCTGC 1 cut(s) 1934
PceI AGGCCT 1 cut(s) 1731
PcsI WCGNNNNNNNCGW 1 cut(s) 652
PctI GAATGC 1 cut(s) 2978
PdmI GAANNNNTTC 7 cut(s) 598, 810, 1080, 1512, 1606, 2996, 3033
PflMI CCANNNNNTGG 2 cut(s) 1621, 3190
PfoI TCCNGGA 1 cut(s) 3049
PleI GAGTC 5 cut(s) 199, 931, 1752, 2076, 3473
PpsI GAGTC 5 cut(s) 199, 931, 1752, 2076, 3473
PshBI ATTAAT 1 cut(s) 2108
Psp1406I AACGTT 1 cut(s) 2167
Psp6I CCWGG 3 cut(s) 1537, 3049, 3439
PspEI GGTNACC 1 cut(s) 2707
PspGI CCWGG 3 cut(s) 1537, 3049, 3439
PspN4I GGNNCC 3 cut(s) 324, 341, 668
PspPI GGNCC 5 cut(s) 289, 977, 1501, 1717, 3437
PspXI VCTCGAGB 1 cut(s) 705
PstI CTGCAG 1 cut(s) 2267
PstNI CAGNNNCTG 2 cut(s) 869, 2071
PsuI RGATCY 6 cut(s) 197, 322, 666, 1442, 1787, 1969
RsaI GTAC 3 cut(s) 2866, 3114, 3382
RsaNI GTAC 3 cut(s) 2865, 3113, 3381
RseI CAYNNNNRTG 5 cut(s) 90, 125, 593, 1625, 3084
Sau96I GGNCC 5 cut(s) 289, 977, 1501, 1717, 3437
SchI GAGTC 5 cut(s) 200, 931, 1752, 2077, 3474
ScrFI CCNGG 5 cut(s) 981, 1505, 1539, 3051, 3441
SduI GDGCHC 1 cut(s) 3183
SfaNI GCATC 8 cut(s) 1030, 1147, 1467, 2301, 2324, 2465, 2878, 2900
SfcI CTRYAG 1 cut(s) 2263
Sfr274I CTCGAG 1 cut(s) 705
SfuI TTCGAA 1 cut(s) 2982
SinI GGWCC 2 cut(s) 977, 1717
SlaI CTCGAG 1 cut(s) 705
SmiMI CAYNNNNRTG 5 cut(s) 90, 125, 593, 1625, 3084
SmlI CTYRAG 6 cut(s) 143, 705, 1753, 1783, 1958, 2774
SmoI CTYRAG 6 cut(s) 143, 705, 1753, 1783, 1958, 2774
SphI GCATGC 1 cut(s) 679
SseBI AGGCCT 1 cut(s) 1731
SsiI CCGC 7 cut(s) 67, 337, 604, 679, 886, 1840, 2602
SspI AATATT 2 cut(s) 1332, 3061
SspMI CTAG 4 cut(s) 195, 791, 1391, 2843
StuI AGGCCT 1 cut(s) 1731
StyD4I CCNGG 5 cut(s) 979, 1503, 1537, 3049, 3439
StyI CCWWGG 3 cut(s) 670, 1615, 2011
TaaI ACNGT 7 cut(s) 1070, 1524, 2381, 2732, 3134, 3401, 3407
TaiI ACGT 3 cut(s) 1062, 1549, 2170
TaqI TCGA 4 cut(s) 706, 1764, 2982, 3261
TaqII GACCGA 2 cut(s) 150, 756
TatI WGTACW 1 cut(s) 2864
TauI GCSGC 2 cut(s) 340, 1842
TscAI CASTG 3 cut(s) 2877, 3532, 3598
TseFI GTSAC 3 cut(s) 1378, 2242, 2707
TseI GCWGC 8 cut(s) 95, 179, 452, 869, 956, 1842, 2289, 3597
Tsp45I GTSAC 3 cut(s) 1378, 2242, 2707
TspGWI ACGGA 4 cut(s) 544, 1167, 3088, 3458
TspRI CASTG 3 cut(s) 2877, 3532, 3598
Van91I CCANNNNNTGG 2 cut(s) 1621, 3190
Vha464I CTTAAG 2 cut(s) 1753, 1783
VpaK11BI GGWCC 2 cut(s) 977, 1717
VspI ATTAAT 1 cut(s) 2108
XbaI TCTAGA 1 cut(s) 194
XceI RCATGY 1 cut(s) 679
XcmI CCANNNNNNNNNTGG 3 cut(s) 826, 2009, 3086
XhoI CTCGAG 1 cut(s) 705
XmiI GTMKAC 1 cut(s) 2839
XmnI GAANNNNTTC 7 cut(s) 598, 810, 1080, 1512, 1606, 2996, 3033
XspI CTAG 4 cut(s) 195, 791, 1391, 2843
Zsp2I ATGCAT 3 cut(s) 278, 1482, 2893
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.