Rmu_sc0002634.1_g000038

resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002634.1
OG0000105
Physical Location & Seq
Reverse (-)
170415 .. 177090
6676 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002634.1_g000038.1.cds

Sequence Viewer

Length: 3969 bp
atgcttaggcgtttcaacattgacaagattaagccttcaagcaccccaatggtcgttcgtagtcttgatccaaagaatgatccattttgtccaaaagatgacgatgaagaagtgttagaggctaaagtgccctacctaagtgcaataggcgcattattagagacgatggattcagacccatcaaatgcaagggacgccacacatggtggactacgttccctctccccatcccaaaacgatataagtgttttggaagaaagggcggaggcggaggcgacatcaatgctggaggcggaggcggcatcgacgctggaggcggaggcggcatcgacgctggaggaggcggaaaaggctaatgggttgggtccaaatgagacggaaagcgagtctgattcaattccgattaggagatctatggcgtcaacctcttctcgtcgtcaatggaaatacgatgtgtttctaagtttcagggggggagatacgcgctatggttttacccatgatctgtatactgcattaaagcagagaggaattctcacctttcgggatgacccagagcttgagaaaggaaaatccattagacctgaacttttagctgcaattgaggagtctagatctgcgattgtcattctctcagagaattatgcttgttcgtcatggtgcttggatgaactcgtcaaaattattcaatgcatgaaagatatgggccaacaagtcttccccgtcttctacgtcgtggatccttctgatgtgcggcaccaaacgggaagttttgagctcaaaggggaaccccaagtacaagtaagggaacatgaagaagtttatgggaagcctagtgaggacagactaaatgcctggagagctgctttgactgaggtcgccaatctttctggctggcatgccaagtatactctatatgactcaagtttgactgaggaaattgttaatcatatactaaagaagtccgtgtatgtatcttcgagtgttgacaagggcttcataggaatgggttcccgcattgatggtttattaagccattacatatgtccacagcttggtggggtgcgttttatagggatccatggcatgcggggcataggtaagacaacacttgctcgagctatccatgatgaaatttgtcaggattttgaccaaacctgctttctttccaatgttagagaaatgtctaaaaccaatggcctagtttctctacaagaaaaacttctttccagaatcctgatggtaaaaattgaaaatatagacgatgaatacacaggagctgctatgatagaaaggcggttgtgtagaataaaggtgcttgttgttattgatgatgtggatcagttgacacaattagagaaattggctggaagtcgcaactggtttggtcaggggagtagaattatcataaccaccacagatgttcagttgttaaaggcacatgatgttgatgctacatacaaggcttatgggttaaaatgtgatgaagcatttcaactcttgagtttgaaggcttttaggaaatgtcccccaccagaagattatttgcatctgtgctaccatattttagggtatgctcaggggcttccgttggctgtcgtcgttttaggttcttttctatttggtagaagcactgatgaatgggcaagtgcaatagataggttaaagaacacaccacataaacgaattatggaggtgcttcggattagttttgatggactggatgaaaaagacagagaaatattcctacatatcgcttgcttttacaaggggaaggataagaatcgtgtgacacaaatactagactattgccagctaaaccctgtcattggtttaagtgttcttgctgatagatctctcataactatctccaacaacgaactgtcgatgcatgatttgctacaagagacgggctgggaaattgttcgtgaacagtctcctaaagagccaggcaaacgtagtagattatggtctcatgaagatatcaacaatgtgctgaagagaaataagggaacagattcaatccaaggcatggtaatggagttgactaaattacaagtggctcattggaagccagaagccttttcaaatttgtctcaacttagtcttctccatattcgtaatgtggaccttcccgacggcctcacctgtctttctaattccttgagactcctcgaatggactgagtatcccttgagatctctcccacaaaattttgaagcagatgaacttattgaactcaacttgtgccacagcaacattgaacagctttggaagggaacaaagaattttgacaagttgaagttcatcaaactctgccattctcaaaacattgtggagaccccagacctcgcagacgttcagaatcttgagagtttagatcttgaaggatgtgaaaatttggtaagaatccatcaatcccttggatttctcaaaaagcttattgtcctgaatcttaaagactgcaaaagtctcgagagtctgcctagtagaattgaaatggaatctcttgaaacattaattctttctaactgctcaaaagttaagaagatccccgagtttgttggaaatatggaacgtttgtcggtgctttgtcttgatcagactgccattgaggaactgcctgtttcaattgaacggctgactggccttgtgacattgaatctgagcaactgcagaaatcttgtatgtcttccaagtaccatcaataaattgaagtctgttgaaaatcttaatctttctggatgcttgaaactcggcaaacatcaggtaaatgtgggggagatggaatgtttcgaggaaactgatgtgaatagtgggtctgcaatagaaatttcaactacccatgatcgcataaaatatgtgagaggttcattctttcatggatgcgaagcagtttgggaatcttcaaataagttcctgccttctggattggtgcaaaaagtgaatacagcgccaatgtgtttctgcttgcctatatctggtctgcgtaatttaacatatctgaacttgagtaattgcaatcttggtgaaggagcatttgccaacgaatttggttactttccctctttggcgaccttgaatctaagtggaaacaattttgttcatcttcctccaggcattggattgctttctaagcttgagaactttaacttggagaattgcaagagacttcaagacttgtcagaccttccatcaaatagtatactagatttaagggcagatggttgtacttcactgaaatacctgtttgatgcatcgaatttgaacagattaaacaaatcatatttcaatttcatcaattgcttcaatctaaatggcaatcaagggtgcaataacatagcatttgaaatgctgatgacagtcatgtatcaggcaatctctaataaaagggaaacttttcaaattgtaattcctggatgttatattcctgactggttcaaccattggagttttggttgttcattaagtgtatctctacctgcacattggaataacagtcggtttatgggatttgctttgtgtgcggtttttgtactccacgagcaccaacgggtggatgagctttatatagatgaatttaagacttttaatgcaacacatcatcttgtatgttgcctgaagctcaatggaagagaattggaagtctacggcagacagcctgcatttcgctttagtgaaaatttttgccaggttgagtcagatcatctgtggctattctatgtatcttgtgataagtactttggtatagagtggtggcctaatagttgcagtcaggttgagttcttatatgaaaccagagggccgggtctgaaggtgaaggagtgtggagggaaaccagtggcactggtagcagaacttgcatgcttgaagaattgtaggactggcagaaatataggggatccaccactggccactgcaattaaggactttctgatcccatggttggaaatgagttgcagatcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC TIR

Protein Analysis

1322

Amino Acids

149.11

Weight (kDa)

5.58

Isoelectric Point (pI)

44.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000105)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g00561 FvH4_2g00570
malus_domestica MD10G1006400.v1.1 MD10G1006800.v1.1 MD10G1007300.v1.1 MD12G1125200.v1.1 MD12G1125400.v1.1
prunus_persica Prupe.2G059200_v2.0.a1 Prupe.8G005200_v2.0.a1 Prupe.8G046600_v2.0.a1
pyrus_communis pycom10g00460 pycom12g12340 pycom12g12360 pycom14g00580
rosa_chinensis RchiOBHm_Chr1g0315021 RchiOBHm_Chr1g0319431 RchiOBHm_Chr1g0319441 RchiOBHm_Chr1g0321301 RchiOBHm_Chr1g0322041 RchiOBHm_Chr1g0322381 RchiOBHm_Chr1g0322421 RchiOBHm_Chr1g0322491 RchiOBHm_Chr1g0322521 RchiOBHm_Chr1g0322531 RchiOBHm_Chr1g0322651 RchiOBHm_Chr1g0322701 RchiOBHm_Chr1g0322711 RchiOBHm_Chr1g0322741 RchiOBHm_Chr1g0322781 RchiOBHm_Chr1g0322831 RchiOBHm_Chr1g0322941 RchiOBHm_Chr1g0322961 RchiOBHm_Chr1g0323161 RchiOBHm_Chr1g0323221 RchiOBHm_Chr1g0323401 RchiOBHm_Chr1g0323411 RchiOBHm_Chr1g0323501 RchiOBHm_Chr1g0323611 RchiOBHm_Chr1g0323761 RchiOBHm_Chr1g0328941 RchiOBHm_Chr1g0328951 RchiOBHm_Chr1g0329001 RchiOBHm_Chr2g0101061 RchiOBHm_Chr5g0055671 RchiOBHm_Chr6g0244821 RchiOBHm_Chr6g0244831 RchiOBHm_Chr6g0244851 RchiOBHm_Chr6g0247291 RchiOBHm_Chr6g0247321 RchiOBHm_Chr6g0247331 RchiOBHm_Chr6g0250501 RchiOBHm_Chr6g0250511 RchiOBHm_Chr6g0250551 RchiOBHm_Chr6g0250581 RchiOBHm_Chr6g0250621 RchiOBHm_Chr6g0250681 RchiOBHm_Chr6g0250801 RchiOBHm_Chr6g0250831 RchiOBHm_Chr6g0250871 RchiOBHm_Chr6g0250911 RchiOBHm_Chr6g0250931 RchiOBHm_Chr6g0251011
rosa_laevigata RLG00000002602 RLG00000013892 RLG00000015208 RLG00000015326 RLG00000015500 RLG00000015524 RLG00000015527 RLG00000015528 RLG00000015531 RLG00000015536 RLG00000016540 RLG00000017048 RLG00000023324 RLG00000024652 RLG00000030298 RLG00000030301 RLG00000030303 RLG00000030304 RLG00000030318 RLG00000030322 RLG00000030325 RLG00000030326 RLG00000030331 RLG00000030350 RLG00000030354 RLG00000030357 RLG00000030358 RLG00000030367 RLG00000030369 RLG00000030382 RLG00000030389 RLG00000035003
rosa_multiflora Rmu_sc0000252.1_g000011 Rmu_sc0000252.1_g000020 Rmu_sc0000252.1_g000029 Rmu_sc0000276.1_g000063 Rmu_sc0000504.1_g000023 Rmu_sc0000745.1_g000032 Rmu_sc0000745.1_g000041 Rmu_sc0000749.1_g000028 Rmu_sc0000749.1_g000035 Rmu_sc0000749.1_g000041 Rmu_sc0000749.1_g000052 Rmu_sc0000804.1_g000001 Rmu_sc0001168.1_g000012 Rmu_sc0001209.1_g000011 Rmu_sc0001209.1_g000022 Rmu_sc0001209.1_g000029 Rmu_sc0001209.1_g000031 Rmu_sc0001209.1_g000032 Rmu_sc0001932.1_g000010 Rmu_sc0001932.1_g000023 Rmu_sc0001932.1_g000028 Rmu_sc0002132.1_g000015 Rmu_sc0002132.1_g000031 Rmu_sc0002132.1_g000047 Rmu_sc0002263.1_g000015 Rmu_sc0002263.1_g000024 Rmu_sc0002263.1_g000028 Rmu_sc0002263.1_g000030 Rmu_sc0002263.1_g000039 Rmu_sc0002634.1_g000017 Rmu_sc0002634.1_g000024 Rmu_sc0002634.1_g000038 Rmu_sc0003226.1_g000025 Rmu_sc0003226.1_g000083 Rmu_sc0003226.1_g000084 Rmu_sc0003413.1_g000022 Rmu_sc0003413.1_g000023 Rmu_sc0003418.1_g000011 Rmu_sc0003418.1_g000012 Rmu_sc0003743.1_g000036 Rmu_sc0004185.1_g000005 Rmu_sc0004368.1_g000015 Rmu_sc0004368.1_g000031 Rmu_sc0004368.1_g000032 Rmu_sc0004439.1_g000008 Rmu_sc0006638.1_g000017 Rmu_sc0007485.1_g000009 Rmu_sc0007698.1_g000015 Rmu_sc0009428.1_g000002 Rmu_sc0012920.1_g000010 Rmu_sc0019291.1_g000002 Rmu_sc0026821.1_g000001
rosa_roxburghii Rroxscaffold_160G00433940 Rroxscaffold_180G00433550 Rroxscaffold_1G00024620 Rroxscaffold_2G00121250 Rroxscaffold_2G00141590 Rroxscaffold_2G00146640 Rroxscaffold_2G00146660 Rroxscaffold_4G00320080 Rroxscaffold_4G00321280 Rroxscaffold_4G00326440 Rroxscaffold_4G00326450 Rroxscaffold_4G00326500 Rroxscaffold_4G00326530 Rroxscaffold_4G00326610 Rroxscaffold_4G00326620 Rroxscaffold_4G00326770 Rroxscaffold_4G00326830 Rroxscaffold_4G00326870 Rroxscaffold_4G00326930 Rroxscaffold_4G00326940 Rroxscaffold_4G00326960 Rroxscaffold_4G00326980 Rroxscaffold_4G00327010 Rroxscaffold_4G00327110 Rroxscaffold_4G00327120 Rroxscaffold_4G00327140 Rroxscaffold_4G00327190 Rroxscaffold_4G00327200 Rroxscaffold_4G00327230 Rroxscaffold_4G00327260 Rroxscaffold_4G00327270 Rroxscaffold_4G00327320 Rroxscaffold_4G00327330 Rroxscaffold_7G00198650 Rroxscaffold_7G00214100 Rroxscaffold_7G00217130 Rroxscaffold_7G00217160 Rroxscaffold_7G00217180
rosa_rugosa Rorug01G0034500 Rorug01G0035700 Rorug01G0036000 Rorug01G0036100 Rorug01G0036200 Rorug01G0036700 Rorug01G0037900 Rorug01G0038000 Rorug01G0039000.1 Rorug01G0039400 Rorug02G0096400 Rorug02G0096500 Rorug02G0096600 Rorug02G0096700 Rorug02G0096800 Rorug05G0294500 Rorug05G0497900 Rorug05G0499300 Rorug05G0524600 Rorug06G0043700 Rorug06G0044200 RorugPtG0003400.1
rosa_samantha Rh1BG033300 Rh1BG046700 Rh1BG047600 Rh1BG109300 Rh2CG149400 Rh5CG398600 Rh5CG398700 Rh6DG004400 Rh6DG004700 Rh6DG004900 Rh6DG032100 Rh6DG032400
rosa_wichuraiana Rw0G001800 Rw0G020500 Rw0G020900 Rw1G003430 Rw1G003890 Rw1G004390 Rw1G004400 Rw1G004440 Rw1G004470 Rw1G004490 Rw1G004500 Rw1G004510 Rw1G004570 Rw1G004610 Rw1G004660 Rw1G004680 Rw1G004700 Rw1G004780 Rw1G004800 Rw1G004830 Rw1G005020 Rw2G011250 Rw2G024080 Rw2G024100 Rw3G022830 Rw6G000680 Rw6G000750 Rw6G000780 Rw6G000810 Rw6G000830 Rw6G000860 Rw6G002220 Rw6G002240 Rw6G003350 Rw6G003380 Rw6G003430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 1166, 3490
AccB1I GGYRCC 1 cut(s) 756
AccB7I CCANNNNNTGG 4 cut(s) 1055, 2032, 3122, 3556
AccI GTMKAC 4 cut(s) 509, 908, 3205, 3648
AccII CGCG 1 cut(s) 484
AclI AACGTT 1 cut(s) 2578
AcoI YGGCCR 1 cut(s) 3912
AcuI CTGAAG 3 cut(s) 2018, 3641, 3833
AcyI GRCGYC 2 cut(s) 195, 419
AdeI CACNNNGTG 1 cut(s) 206
AfaI GTAC 5 cut(s) 798, 2701, 3232, 3537, 3740
AfiI CCNNNNNNNGG 7 cut(s) 1055, 1829, 2032, 2981, 3122, 3556, 3946
AjnI CCWGG 5 cut(s) 854, 1948, 3115, 3415, 3690
AjuI GAANNNNNNNTTGG 4 cut(s) 1146, 1178, 3137, 3169
Alw21I GWGCWC 2 cut(s) 780, 3549
AlwNI CAGNNNCTG 1 cut(s) 1280
Ama87I CYCGRG 3 cut(s) 1116, 2474, 2555
AoxI GGCC 7 cut(s) 706, 1198, 2140, 2647, 3758, 3803, 3912
ApeKI GCWGC 3 cut(s) 596, 863, 1280
AseI ATTAAT 1 cut(s) 2519
Asp700I GAANNNNTTC 6 cut(s) 1009, 1221, 1491, 1923, 2017, 3399
AspLEI GCGC 3 cut(s) 152, 486, 2956
AspS9I GGNCC 4 cut(s) 365, 706, 2128, 3803
AsuC2I CCSGG 1 cut(s) 3807
AsuHPI GGTGA 4 cut(s) 529, 2137, 3041, 3829
AvaI CYCGRG 3 cut(s) 1116, 2474, 2555
AvaII GGWCC 2 cut(s) 365, 2128
BaeGI GKGCMC 1 cut(s) 132
BalI TGGCCA 1 cut(s) 3914
BamHI GGATCC 3 cut(s) 739, 1077, 3901
BanI GGYRCC 1 cut(s) 756
BanII GRGCYC 1 cut(s) 780
BauI CACGAG 1 cut(s) 3542
BbsI GAAGAC 4 cut(s) 709, 718, 2099, 2684
Bbv12I GWGCWC 2 cut(s) 780, 3549
BbvI GCAGC 3 cut(s) 583, 850, 1267
BceAI ACGGC 3 cut(s) 2155, 2654, 3667
BcgI CGANNNNNNTGC 4 cut(s) 265, 299, 2455, 2489
BciT130I CCWGG 5 cut(s) 856, 1950, 3117, 3417, 3692
BciVI GTATCC 1 cut(s) 2199
BclI TGATCA 1 cut(s) 2599
BcnI CCSGG 1 cut(s) 3807
BfaI CTAG 6 cut(s) 612, 834, 1202, 1802, 2487, 3209
BfmI CTRYAG 1 cut(s) 2674
BfoI RGCGCY 1 cut(s) 2957
BfuAI ACCTGC 2 cut(s) 1166, 3490
BfuI GTATCC 1 cut(s) 2199
BglII AGATCT 5 cut(s) 410, 614, 1853, 2198, 2380
BisI GCNGC 6 cut(s) 300, 324, 597, 755, 864, 1281
BlsI GCNGC 6 cut(s) 301, 325, 598, 756, 865, 1282
BmcAI AGTACT 1 cut(s) 3740
Bme1390I CCNGG 6 cut(s) 856, 1950, 3117, 3417, 3692, 3807
Bme18I GGWCC 2 cut(s) 365, 2128
BmeT110I CYCGRG 3 cut(s) 1116, 2474, 2555
BmgT120I GGNCC 4 cut(s) 365, 706, 2128, 3803
BmiI GGNNCC 7 cut(s) 366, 741, 758, 789, 1012, 1079, 3903
BmrFI CCNGG 6 cut(s) 856, 1950, 3117, 3417, 3692, 3807
BmsI GCATC 9 cut(s) 311, 335, 1441, 1558, 1878, 2735, 2876, 3244, 3266
BoxI GACNNNNGTC 1 cut(s) 875
BpiI GAAGAC 4 cut(s) 709, 718, 2099, 2684
BplI GAGNNNNNCTC 2 cut(s) 519, 551
BpmI CTGGAG 5 cut(s) 308, 332, 356, 877, 3099
Bpu10I CCTNAGC 2 cut(s) 5, 1578
BpuEI CTTGAG 8 cut(s) 581, 907, 1522, 2185, 2215, 2390, 3031, 3161
BpuMI CCSGG 1 cut(s) 3807
BsaBI GATNNNNATC 2 cut(s) 1338, 1782
BsaHI GRCGYC 2 cut(s) 195, 419
BsaI GGTCTC 2 cut(s) 1977, 2333
BsaJI CCNNGG 4 cut(s) 1081, 2026, 2422, 3941
BsaXI ACNNNNNCTCC 2 cut(s) 3442, 3472
Bsc4I CCNNNNNNNGG 7 cut(s) 1055, 1829, 2032, 2981, 3122, 3556, 3946
Bse1I ACTGG 8 cut(s) 1385, 1725, 2650, 3440, 3839, 3852, 3889, 3915
Bse8I GATNNNNATC 2 cut(s) 1338, 1782
BseBI CCWGG 5 cut(s) 856, 1950, 3117, 3417, 3692
BseDI CCNNGG 4 cut(s) 1081, 2026, 2422, 3941
BseGI GGATG 9 cut(s) 227, 553, 673, 1729, 2396, 2750, 2891, 3425, 3565
BseJI GATNNNNATC 2 cut(s) 1338, 1782
BseLI CCNNNNNNNGG 7 cut(s) 1055, 1829, 2032, 2981, 3122, 3556, 3946
BseMII CTCAG 6 cut(s) 648, 864, 924, 1592, 2175, 2657
BseNI ACTGG 8 cut(s) 1385, 1725, 2650, 3440, 3839, 3852, 3889, 3915
BseRI GAGGAG 3 cut(s) 353, 620, 2162
BseSI GKGCMC 1 cut(s) 132
BseXI GCAGC 3 cut(s) 583, 850, 1267
BseYI CCCAGC 1 cut(s) 1914
BsgI GTGCAG 1 cut(s) 3468
Bsh1236I CGCG 1 cut(s) 484
BshFI GGCC 7 cut(s) 708, 1200, 2142, 2649, 3760, 3805, 3914
BshNI GGYRCC 1 cut(s) 756
BsiHKAI GWGCWC 2 cut(s) 780, 3549
BsiHKCI CYCGRG 3 cut(s) 1116, 2474, 2555
BsiSI CCGG 1 cut(s) 3806
BslFI GGGAC 2 cut(s) 206, 1512
BslI CCNNNNNNNGG 7 cut(s) 1055, 1829, 2032, 2981, 3122, 3556, 3946
BsmBI CGTCTC 3 cut(s) 155, 368, 1901
BsmFI GGGAC 2 cut(s) 206, 1512
BsnI GGCC 7 cut(s) 708, 1200, 2142, 2649, 3760, 3805, 3914
Bso31I GGTCTC 2 cut(s) 1977, 2333
BsoBI CYCGRG 3 cut(s) 1116, 2474, 2555
Bsp1286I GDGCHC 3 cut(s) 132, 780, 3549
Bsp19I CCATGG 2 cut(s) 1081, 3941
BspANI GGCC 7 cut(s) 708, 1200, 2142, 2649, 3760, 3805, 3914
BspCNI CTCAG 6 cut(s) 647, 865, 925, 1591, 2176, 2658
BspFNI CGCG 1 cut(s) 484
BspHI TCATGA 2 cut(s) 1975, 3965
BspLI GGNNCC 7 cut(s) 366, 741, 758, 789, 1012, 1079, 3903
BspMAI CTGCAG 1 cut(s) 2678
BspMI ACCTGC 2 cut(s) 1166, 3490
BspT107I GGYRCC 1 cut(s) 756
BspTNI GGTCTC 2 cut(s) 1977, 2333
BsrI ACTGG 8 cut(s) 1385, 1725, 2650, 3440, 3839, 3852, 3889, 3915
BssECI CCNNGG 4 cut(s) 1081, 2026, 2422, 3941
BssNAI GTATAC 3 cut(s) 510, 909, 3206
BssNI GRCGYC 2 cut(s) 195, 419
BssSI CACGAG 1 cut(s) 3542
BssT1I CCWWGG 4 cut(s) 1081, 2026, 2422, 3941
Bst1107I GTATAC 3 cut(s) 510, 909, 3206
Bst2BI CACGAG 1 cut(s) 3542
Bst2UI CCWGG 5 cut(s) 856, 1950, 3117, 3417, 3692
Bst4CI ACNGT 4 cut(s) 1884, 1935, 3364, 3500
Bst6I CTCTTC 3 cut(s) 433, 1994, 3628
BstACI GRCGYC 2 cut(s) 195, 419
BstAPI GCANNNNNTGC 2 cut(s) 1897, 3860
BstC8I GCNNGC 8 cut(s) 896, 900, 1088, 1759, 1814, 2972, 3663, 3865
BstDSI CCRYGG 2 cut(s) 1081, 3941
BstF5I GGATG 9 cut(s) 227, 553, 673, 1729, 2396, 2750, 2891, 3425, 3565
BstFNI CGCG 1 cut(s) 484
BstH2I RGCGCY 1 cut(s) 2957
BstHHI GCGC 3 cut(s) 152, 486, 2956
BstNI CCWGG 5 cut(s) 856, 1950, 3117, 3417, 3692
BstNSI RCATGY 3 cut(s) 902, 1090, 3867
BstPAI GACNNNNGTC 1 cut(s) 875
BstSCI CCNGG 6 cut(s) 854, 1948, 3115, 3415, 3690, 3805
BstSFI CTRYAG 1 cut(s) 2674
BstSLI GKGCMC 1 cut(s) 132
BstUI CGCG 1 cut(s) 484
BstV1I GCAGC 3 cut(s) 583, 850, 1267
BstV2I GAAGAC 4 cut(s) 709, 718, 2099, 2684
BstX2I RGATCY 9 cut(s) 410, 614, 739, 1077, 1853, 2198, 2380, 2550, 3901
BstYI RGATCY 9 cut(s) 410, 614, 739, 1077, 1853, 2198, 2380, 2550, 3901
BstZ17I GTATAC 3 cut(s) 510, 909, 3206
BsuI GTATCC 1 cut(s) 2199
BsuRI GGCC 7 cut(s) 708, 1200, 2142, 2649, 3760, 3805, 3914
BtgI CCRYGG 2 cut(s) 1081, 3941
BtsCI GGATG 9 cut(s) 227, 553, 673, 1729, 2396, 2750, 2891, 3425, 3565
BtsI GCAGTG 1 cut(s) 3915
BtsIMutI CAGTG 6 cut(s) 1632, 3236, 3845, 3846, 3908, 3915
BveI ACCTGC 2 cut(s) 1166, 3490
Cac8I GCNNGC 8 cut(s) 896, 900, 1088, 1759, 1814, 2972, 3663, 3865
CaiI CAGNNNCTG 1 cut(s) 1280
CciI TCATGA 2 cut(s) 1975, 3965
CfoI GCGC 3 cut(s) 152, 486, 2956
Cfr13I GGNCC 4 cut(s) 365, 706, 2128, 3803
CseI GACGC 4 cut(s) 203, 316, 340, 408
Csp6I GTAC 5 cut(s) 797, 2700, 3231, 3536, 3739
CviQI GTAC 5 cut(s) 797, 2700, 3231, 3536, 3739
DraIII CACNNNGTG 1 cut(s) 206
EaeI YGGCCR 1 cut(s) 3912
Eam1104I CTCTTC 3 cut(s) 433, 1994, 3628
EarI CTCTTC 3 cut(s) 433, 1994, 3628
EciI GGCGGA 5 cut(s) 278, 284, 308, 332, 359
Ecl136II GAGCTC 1 cut(s) 778
Eco130I CCWWGG 4 cut(s) 1081, 2026, 2422, 3941
Eco24I GRGCYC 1 cut(s) 780
Eco31I GGTCTC 2 cut(s) 1977, 2333
Eco32I GATATC 1 cut(s) 1984
Eco47I GGWCC 2 cut(s) 365, 2128
Eco53kI GAGCTC 1 cut(s) 778
Eco57I CTGAAG 3 cut(s) 2018, 3641, 3833
Eco88I CYCGRG 3 cut(s) 1116, 2474, 2555
EcoICRI GAGCTC 1 cut(s) 778
EcoRI GAATTC 1 cut(s) 531
EcoRII CCWGG 5 cut(s) 854, 1948, 3115, 3415, 3690
EcoRV GATATC 1 cut(s) 1984
EcoT14I CCWWGG 4 cut(s) 1081, 2026, 2422, 3941
EcoT22I ATGCAT 3 cut(s) 695, 1893, 3259
EcoT38I GRGCYC 1 cut(s) 780
ErhI CCWWGG 4 cut(s) 1081, 2026, 2422, 3941
Esp3I CGTCTC 3 cut(s) 155, 368, 1901
FalI AAGNNNNNCTT 4 cut(s) 1206, 1238, 3382, 3414
FaqI GGGAC 2 cut(s) 206, 1512
FauI CCCGC 2 cut(s) 1022, 1083
FauNDI CATATG 1 cut(s) 1043
FbaI TGATCA 1 cut(s) 2599
FblI GTMKAC 4 cut(s) 509, 908, 3205, 3648
Fnu4HI GCNGC 6 cut(s) 300, 324, 597, 755, 864, 1281
FokI GGATG 9 cut(s) 214, 560, 680, 1736, 2403, 2757, 2898, 3432, 3572
FriOI GRGCYC 1 cut(s) 780
Fsp4HI GCNGC 6 cut(s) 300, 324, 597, 755, 864, 1281
FspBI CTAG 6 cut(s) 612, 834, 1202, 1802, 2487, 3209
GlaI GCGC 3 cut(s) 151, 485, 2955
GluI GCNGC 6 cut(s) 300, 324, 597, 755, 864, 1281
GsaI CCCAGC 1 cut(s) 1918
GsuI CTGGAG 5 cut(s) 308, 332, 356, 877, 3099
HaeII RGCGCY 1 cut(s) 2957
HaeIII GGCC 7 cut(s) 708, 1200, 2142, 2649, 3760, 3805, 3914
HapII CCGG 1 cut(s) 3806
HgaI GACGC 4 cut(s) 203, 316, 340, 408
HhaI GCGC 3 cut(s) 152, 486, 2956
Hin1I GRCGYC 2 cut(s) 195, 419
Hin6I GCGC 3 cut(s) 150, 484, 2954
HinP1I GCGC 3 cut(s) 150, 484, 2954
HincII GTYRAC 4 cut(s) 423, 988, 1347, 2046
HindII GTYRAC 4 cut(s) 423, 988, 1347, 2046
HindIII AAGCTT 2 cut(s) 2438, 3137
HpaII CCGG 1 cut(s) 3806
HphI GGTGA 4 cut(s) 529, 2137, 3041, 3829
Hpy99I CGWCG 6 cut(s) 310, 334, 438, 737, 1604, 2141
HpyCH4III ACNGT 4 cut(s) 1884, 1935, 3364, 3500
HpyCH4IV ACGT 5 cut(s) 214, 732, 1957, 2358, 2578
HpySE526I ACGT 5 cut(s) 214, 732, 1957, 2358, 2578
Hsp92I GRCGYC 2 cut(s) 195, 419
HspAI GCGC 3 cut(s) 150, 484, 2954
Ksp22I TGATCA 1 cut(s) 2599
LmnI GCTCC 2 cut(s) 1277, 3035
Lsp1109I GCAGC 3 cut(s) 583, 850, 1267
LweI GCATC 9 cut(s) 311, 335, 1441, 1558, 1878, 2735, 2876, 3244, 3266
MaeI CTAG 6 cut(s) 612, 834, 1202, 1802, 2487, 3209
MaeII ACGT 5 cut(s) 214, 732, 1957, 2358, 2578
MaeIII GTNAC 3 cut(s) 1789, 2653, 3056
MfeI CAATTG 3 cut(s) 600, 2631, 3301
MflI RGATCY 9 cut(s) 410, 614, 739, 1077, 1853, 2198, 2380, 2550, 3901
MhlI GDGCHC 3 cut(s) 132, 780, 3549
MlsI TGGCCA 1 cut(s) 3914
MluNI TGGCCA 1 cut(s) 3914
MlyI GAGTC 6 cut(s) 395, 617, 914, 2163, 2488, 3707
MmeI TCCRAC 3 cut(s) 1896, 2545, 3927
Mox20I TGGCCA 1 cut(s) 3914
Mph1103I ATGCAT 3 cut(s) 695, 1893, 3259
MroXI GAANNNNTTC 6 cut(s) 1009, 1221, 1491, 1923, 2017, 3399
MscI TGGCCA 1 cut(s) 3914
MslI CAYNNNNRTG 3 cut(s) 47, 1004, 2036
Msp20I TGGCCA 1 cut(s) 3914
MspI CCGG 1 cut(s) 3806
MspR9I CCNGG 6 cut(s) 856, 1950, 3117, 3417, 3692, 3807
MunI CAATTG 3 cut(s) 600, 2631, 3301
MvaI CCWGG 5 cut(s) 856, 1950, 3117, 3417, 3692
MvnI CGCG 1 cut(s) 484
NciI CCSGG 1 cut(s) 3807
NcoI CCATGG 2 cut(s) 1081, 3941
NdeI CATATG 1 cut(s) 1043
NlaIV GGNNCC 7 cut(s) 366, 741, 758, 789, 1012, 1079, 3903
NmeAIII GCCGAG 1 cut(s) 2736
NmuCI GTSAC 2 cut(s) 1789, 2653
NsiI ATGCAT 3 cut(s) 695, 1893, 3259
NspI RCATGY 3 cut(s) 902, 1090, 3867
PaeI GCATGC 3 cut(s) 902, 1090, 3867
PaeR7I CTCGAG 2 cut(s) 1116, 2474
PagI TCATGA 2 cut(s) 1975, 3965
PdmI GAANNNNTTC 6 cut(s) 1009, 1221, 1491, 1923, 2017, 3399
PflMI CCANNNNNTGG 4 cut(s) 1055, 2032, 3122, 3556
PfoI TCCNGGA 1 cut(s) 3415
PkrI GCNGC 6 cut(s) 301, 325, 598, 756, 865, 1282
PleI GAGTC 6 cut(s) 394, 616, 914, 2163, 2487, 3706
PpsI GAGTC 6 cut(s) 394, 616, 914, 2163, 2487, 3706
PshAI GACNNNNGTC 1 cut(s) 875
PshBI ATTAAT 1 cut(s) 2519
Psp124BI GAGCTC 1 cut(s) 780
Psp1406I AACGTT 1 cut(s) 2578
Psp6I CCWGG 5 cut(s) 854, 1948, 3115, 3415, 3690
PspFI CCCAGC 1 cut(s) 1914
PspGI CCWGG 5 cut(s) 854, 1948, 3115, 3415, 3690
PspN4I GGNNCC 7 cut(s) 366, 741, 758, 789, 1012, 1079, 3903
PspPI GGNCC 4 cut(s) 365, 706, 2128, 3803
PspXI VCTCGAGB 1 cut(s) 1116
PsrI GAACNNNNNNTAC 2 cut(s) 780, 812
PstI CTGCAG 1 cut(s) 2678
PstNI CAGNNNCTG 1 cut(s) 1280
PsuI RGATCY 9 cut(s) 410, 614, 739, 1077, 1853, 2198, 2380, 2550, 3901
RsaI GTAC 5 cut(s) 798, 2701, 3232, 3537, 3740
RsaNI GTAC 5 cut(s) 797, 2700, 3231, 3536, 3739
RseI CAYNNNNRTG 3 cut(s) 47, 1004, 2036
SacI GAGCTC 1 cut(s) 780
SatI GCNGC 6 cut(s) 300, 324, 597, 755, 864, 1281
Sau96I GGNCC 4 cut(s) 365, 706, 2128, 3803
ScaI AGTACT 1 cut(s) 3740
SchI GAGTC 6 cut(s) 395, 617, 914, 2163, 2488, 3707
ScrFI CCNGG 6 cut(s) 856, 1950, 3117, 3417, 3692, 3807
SduI GDGCHC 3 cut(s) 132, 780, 3549
SfaNI GCATC 9 cut(s) 311, 335, 1441, 1558, 1878, 2735, 2876, 3244, 3266
SfcI CTRYAG 1 cut(s) 2674
Sfr274I CTCGAG 2 cut(s) 1116, 2474
SinI GGWCC 2 cut(s) 365, 2128
SlaI CTCGAG 2 cut(s) 1116, 2474
SmiMI CAYNNNNRTG 3 cut(s) 47, 1004, 2036
SphI GCATGC 3 cut(s) 902, 1090, 3867
SspI AATATT 1 cut(s) 1743
SspMI CTAG 6 cut(s) 612, 834, 1202, 1802, 2487, 3209
SstI GAGCTC 1 cut(s) 780
StyD4I CCNGG 6 cut(s) 854, 1948, 3115, 3415, 3690, 3805
StyI CCWWGG 4 cut(s) 1081, 2026, 2422, 3941
TaaI ACNGT 4 cut(s) 1884, 1935, 3364, 3500
TaiI ACGT 5 cut(s) 217, 735, 1960, 2361, 2581
TaqI TCGA 9 cut(s) 305, 329, 980, 1117, 1886, 2175, 2475, 2796, 3260
TatI WGTACW 4 cut(s) 796, 3230, 3535, 3738
TauI GCSGC 3 cut(s) 302, 326, 757
TscAI CASTG 6 cut(s) 1639, 3243, 3846, 3852, 3915, 3922
TseFI GTSAC 2 cut(s) 1789, 2653
TseI GCWGC 3 cut(s) 596, 863, 1280
Tsp45I GTSAC 2 cut(s) 1789, 2653
TspGWI ACGGA 3 cut(s) 392, 955, 1578
TspRI CASTG 6 cut(s) 1639, 3243, 3846, 3852, 3915, 3922
Van91I CCANNNNNTGG 4 cut(s) 1055, 2032, 3122, 3556
VpaK11BI GGWCC 2 cut(s) 365, 2128
VspI ATTAAT 1 cut(s) 2519
XbaI TCTAGA 1 cut(s) 611
XceI RCATGY 3 cut(s) 902, 1090, 3867
XcmI CCANNNNNNNNNTGG 3 cut(s) 1237, 2420, 3452
XhoI CTCGAG 2 cut(s) 1116, 2474
XmiI GTMKAC 4 cut(s) 509, 908, 3205, 3648
XmnI GAANNNNTTC 6 cut(s) 1009, 1221, 1491, 1923, 2017, 3399
XspI CTAG 6 cut(s) 612, 834, 1202, 1802, 2487, 3209
ZrmI AGTACT 1 cut(s) 3740
Zsp2I ATGCAT 3 cut(s) 695, 1893, 3259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.