Rmu_sc0005190.1_g000001

Aldo-keto reductase family 4 member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005190.1
Physical Location & Seq
Reverse (-)
8401 .. 16565
8165 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005190.1_g000001.1.cds

Sequence Viewer

Length: 5031 bp
atgtcgtggtggccctcttttctttattacaggtgggtggttctagcagagttctgttctaagatggaggatgtgttgggaggtttagttcagaaaatggcgatcgatgatggaagcgcggtggatgtggttctcccttcggaggtgatggagaaagggccgcgccggttctacctggtcggagagttaatgacgcagaagccatataggatggaatatctcatcaatatgttgcgatccctttggataccggcggcggaccagtccgatcgctcctgcctcatggtttgtccaatagaatatagtaatcggatcctattctccttccggatggagtccgatctacggtgggtgttggaaggaactccatggtcttttgagaaatttctctttgcggtggcagtgacgaatggtctggaggaccctctgagagtgtctctcaaatgtcagttgttttggttaagaattcggggccttccaccagtggtgttggaggaaggtatgcgcgaaggcactggtaaatgtaatggcacaacggtgggagtttatgccagaactaatttcatcagagggaggagtagcttgggtagctatctcaggatccgtgtgggtgtgtatgtggaggcatcgttgaagaaaggcttctcgttcaaggctgctggggagcaaacaagcaggttctatgatttggaatacgaacatcttccttttttctgtttattttgtggcctactcgatcatacagggaagactctctccacaggtgtcactctgttggccaatcataactgccactatatcttcattaggaccatactagactgttccatattctttccatctcttcccatacaaagaggccaagcggctttatacaagcattcatcactctttctacttcatttctgtgaaaatttgaaaatggcggacgatattcgtttctttgagttgaacaccggagccaagatgccttctttgggattagggacctggcagtccagccccggcttggtcggtgaagccgtcgccaccgccatcaaggcaggatataggcatattgattgtgctcaagtctatggcaacgagaaagagattggtttggttttgaagaagctgtttgaagatggtgtggtgaagcgcgaagaattgtggattacctccaagctctggtgtacggatcatgccccagaagatgtaccagaggcattggataggactttgaaagacttgcagcttgattatgttgacttgtacttgatccactggccagtgcggatgaagaaggttgcggtcggttttaagcctgaaaaccttgttgaaccagatatccctggtacttggagagcaatggaaactctctatgattcgtgcaaggctcgagctattggtgtgagcaatttcgctacaaagaagctgtcagatttgctggatgtggcacgtgttcctcctgctgttgaccaagtggagtgccatccttcatggcagcagaccaagctgcgatccttctgcaaatccaagggggttcacctttctggatattcaccactgggttctcctggcacaacatggatcaaaagtgatgtccttaagaatccgattcttctcagcgttgcagagaagctaggtaaaactcctgctcaagttgctcttcgatggggactgcaaatgggtcatagcgttcttccaaagagtactaatgaagcaaggatcaaggagaatctcgatgtctttggctggtctatcccagaggacttgtttgccaagttttctgaaattgagcaggcaaggctgattagagggaactcatttgttcatgacacttttggaccctatagaagtgttgaagaactatgggatgaagctcaaatcaagctcaaagtcacaataacaaacctgagccagaagctcaagcccaagctgcaaggccagaacagaagttcgccacatgttgccatgacaaatgtccagttggatgcgatgtctagatttgtgggaacttggttccatttctttggtatgggacgctcgggatcccgatattgccccgtggggtattgggatcgccggctaggggccttccttacttcttacattggcgatacaagtcttgtgcttcatatatttgtgcctaggaatgcaaggcgagttcatgccacatgtcttccatacagccattacccccagtccccacataagaggagtcttggctggggtgaggagattggtctcacaattgccattgtgtcattatcgcgaatcggtggtggggctttatgtgtcttttggcgcatactttatgccttggtgacacgtgtgctgtcggcagtcgtttttcttgtgcgaaaaggagctgaggcgacgatgcacgacctctgtaactatcagaggtgttggacacgtggtgagatctggtgtcgtcgtccttgcacgtccaacgatccctatactctcgtggtccctatatataggcggaggagggagagtggggtggttactgttcctctattttcgttggagattgagataagaggtgaacaaagttggaatctttggtgtgtcgaaagcctgaatctttcgtttggtggtcaaaactccgggatgttggcattgttgttcctattttcttgttggagaagtgaacaggggagaccggattttgaaatttcgcagagcggttcgttgaaggcgatagataggagaaggttgattgattctgggtgtctgagagaatggcgcggaagcatcgtagtcatggtaggcgggagggttcgtctcgtgggggtggtgaaggtgcttctcgtggcagtggcgatcgagggcgcttcttgcaggagtggtgatggtgctcctcgtggaggggccatgagcccttcccgggatggtagtgaaggtgcctctcgcggaggtgcggtgggtacttctcgaggtggcagtgatggtgtttctcgaggtggtgagggatcctcgcgtagggtcccaattagggttgagcctgttgcgggtccccaggttcccgaggtggaagaagttgaggtgttggagattgctcattcgccaggtgggcggttgttccttggcgagatgcccattgaccagcttaggcagagtatgaccgaggagcagataaacgatatgaggtacacttggggtattccgggtgacgtcctactgcatcctttgagagatagggagtgttttagtcatcgcaagatggggtgggctggcttttacgaatatcagctcaagagtgggttgacgttcctgataccagaggagctgcaatatttgttgtcgtgcctaaatgtatcgttagggcagctatcgccaaaagcattgaggcagttgatggggtactcgaccaagggtggcgatagtgagtgtattaatttcaggggacgtggccgtgcagttattgaggatctcccggttccgacccgtttccagcccatctgtgagtatcgtgattgcattttggttgattttacctttggccggtgcgtgctaatagcgtgtctttgtatcgtagtgaggtatgaggttgacctgaccacactgaagcagaagtgcgtggcgagggtgatgggtgagtttcccaggggagcgaagaggttctttcgcctgtgtaagctcccgatatatgagaagtttaatctggggaggtgtcaggttacccgacgagatgtatatgaggtttcccgatgctgtgctggagtatctcaaccagcatggcgaggggcacgaggctcagtttgctccggaacaggctcgaagtccccaggggccttgaaggcagtaggaggggtggagcgtggtgatgtggctcggccattagacctagtgattgaggtggagatctccgtcgaggaattgcttgaagaagtggagcgacgccaaagcgataccaacgctcgggctcgcctacgcgaggtcattactgttgatagtggggaggcggaggtgaccagccaagttgttggtgagacagggccggttctcaaggtggggacctatggccaggttagcgagggggatggaacccgagtatcgaatacgtgtgctcgcactgacggggtcgggtctaagaaaacgactgtatcgcagctttggctcaggagtcccccagtcggtgttagtgtcgatactcacgggggcaagaggtctcaaactgagaatgtatcgcgctcgagattgacaagtggggactcgcgtggttcgtgcgataaagtttctaggggtctcgcgcgcaccctgggcgagattggagtcactgatggtgccatccttcatatggtcgccaatctgcggaattgtcatcgcaaccgcaatcgtgcaaatgctgaagattcgcgcctggggtatcgggaggctcaggagagactgatgagggctgtgaacatgaattatcatgcctctgctgagttggtagctcactttgatcgggaggtagcccgactgcagggggagttggatgccaaaagggagcaggcacgcgagctgcaaatggaggaggctcgtcgtcaagaggccgaggatgttattgccccgctgagggagtccaacttggatctgactaggaagctacagcgggtggaggatggcttgaaggctttggatcaggttagggcccgggttggagagggtgaagaatgcctgcaagagttggagaggcaagtccgggaacgtgatgcagagttggagcttcccagtgctgctttggagagtttagctcatttttcccgatcgcgtggtggtgttggaaggacagacaaggcggtggatctcgattttcggtcagcccactttcaagaaaatatgaacaaggccttctcggatgggaccctgcactcgatccgagatggtttcgctgctagttggattgatcaggagaagatggtgcgggatatgcaggccaagaaggcagctactatatcgaagcatgtctcggaccaagccagcgatcgcgagacagaggactctactggcgagcgaggggaggtgcgagtggatgcagagggcgaattgaagttttga

Protein Analysis

1676

Amino Acids

187.45

Weight (kDa)

8.54

Isoelectric Point (pI)

47.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000075)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0348161 RchiOBHm_Chr1g0367481 RchiOBHm_Chr1g0368431 RchiOBHm_Chr2g0116021 RchiOBHm_Chr2g0133961 RchiOBHm_Chr4g0390151 RchiOBHm_Chr4g0402771 RchiOBHm_Chr4g0419581 RchiOBHm_Chr5g0054351 RchiOBHm_Chr6g0278891 RchiOBHm_Chr7g0201941 RchiOBHm_Chr7g0242761
rosa_laevigata RLG00000002487 RLG00000002488 RLG00000003412 RLG00000003415 RLG00000013607 RLG00000018981 RLG00000018982 RLG00000034520 RLG00000034521
rosa_multiflora Rmu_co8024510.1_g000001 Rmu_co8121892.1_g000001 Rmu_co8133046.1_g000001 Rmu_co8158032.1_g000001 Rmu_co8181114.1_g000001 Rmu_co8202532.1_g000001 Rmu_co8331471.1_g000001 Rmu_co8340209.1_g000001 Rmu_co8359899.1_g000001 Rmu_co8433657.1_g000002 Rmu_co8436419.1_g000002 Rmu_co8458211.1_g000002 Rmu_co8458731.1_g000002 Rmu_co8466361.1_g000001 Rmu_co8474565.1_g000001 Rmu_co8474565.1_g000002 Rmu_co8482201.1_g000001 Rmu_co8491967.1_g000003 Rmu_co8498095.1_g000001 Rmu_co8513217.1_g000002 Rmu_co8518257.1_g000001 Rmu_co8520425.1_g000003 Rmu_co8521283.1_g000003 Rmu_sc0000029.1_g000029 Rmu_sc0000082.1_g000019 Rmu_sc0000147.1_g000107 Rmu_sc0000212.1_g000005 Rmu_sc0000247.1_g000030 Rmu_sc0000367.1_g000175 Rmu_sc0000433.1_g000035 Rmu_sc0000538.1_g000038 Rmu_sc0000550.1_g000010 Rmu_sc0000635.1_g000007 Rmu_sc0000650.1_g000012 Rmu_sc0000652.1_g000009 Rmu_sc0000652.1_g000010 Rmu_sc0000742.1_g000010 Rmu_sc0000750.1_g000007 Rmu_sc0000750.1_g000008 Rmu_sc0000772.1_g000018 Rmu_sc0000830.1_g000026 Rmu_sc0000859.1_g000006 Rmu_sc0001190.1_g000039 Rmu_sc0001190.1_g000050 Rmu_sc0001190.1_g000051 Rmu_sc0001205.1_g000008 Rmu_sc0001294.1_g000025 Rmu_sc0001366.1_g000010 Rmu_sc0001373.1_g000036 Rmu_sc0001423.1_g000046 Rmu_sc0001788.1_g000014 Rmu_sc0001801.1_g000016 Rmu_sc0001849.1_g000032 Rmu_sc0001967.1_g000002 Rmu_sc0002082.1_g000066 Rmu_sc0002250.1_g000013 Rmu_sc0002322.1_g000039 Rmu_sc0002371.1_g000002 Rmu_sc0002522.1_g000036 Rmu_sc0002532.1_g000048 Rmu_sc0002669.1_g000065 Rmu_sc0002669.1_g000067 Rmu_sc0002669.1_g000069 Rmu_sc0002834.1_g000007 Rmu_sc0003226.1_g000070 Rmu_sc0003260.1_g000018 Rmu_sc0003313.1_g000007 Rmu_sc0003441.1_g000018 Rmu_sc0003490.1_g000008 Rmu_sc0003705.1_g000011 Rmu_sc0003737.1_g000013 Rmu_sc0003748.1_g000020 Rmu_sc0003910.1_g000015 Rmu_sc0003919.1_g000029 Rmu_sc0003919.1_g000031 Rmu_sc0004037.1_g000012 Rmu_sc0004099.1_g000003 Rmu_sc0004122.1_g000013 Rmu_sc0004402.1_g000013 Rmu_sc0004646.1_g000035 Rmu_sc0004688.1_g000024 Rmu_sc0004823.1_g000046 Rmu_sc0004869.1_g000003 Rmu_sc0004869.1_g000004 Rmu_sc0005132.1_g000035 Rmu_sc0005190.1_g000001 Rmu_sc0005229.1_g000005 Rmu_sc0005229.1_g000023 Rmu_sc0005363.1_g000034 Rmu_sc0005537.1_g000006 Rmu_sc0005657.1_g000024 Rmu_sc0005856.1_g000011 Rmu_sc0005856.1_g000012 Rmu_sc0005953.1_g000007 Rmu_sc0005971.1_g000015 Rmu_sc0006287.1_g000004 Rmu_sc0006315.1_g000014 Rmu_sc0006518.1_g000003 Rmu_sc0006695.1_g000066 Rmu_sc0006803.1_g000056 Rmu_sc0006822.1_g000002 Rmu_sc0006926.1_g000011 Rmu_sc0007560.1_g000008 Rmu_sc0007582.1_g000005 Rmu_sc0007618.1_g000025 Rmu_sc0007647.1_g000004 Rmu_sc0007656.1_g000013 Rmu_sc0007877.1_g000011 Rmu_sc0008528.1_g000005 Rmu_sc0008528.1_g000006 Rmu_sc0008749.1_g000004 Rmu_sc0008989.1_g000003 Rmu_sc0009120.1_g000010 Rmu_sc0009663.1_g000009 Rmu_sc0010035.1_g000001 Rmu_sc0010160.1_g000010 Rmu_sc0010160.1_g000011 Rmu_sc0010953.1_g000004 Rmu_sc0011008.1_g000006 Rmu_sc0011452.1_g000009 Rmu_sc0012746.1_g000014 Rmu_sc0013612.1_g000017 Rmu_sc0013951.1_g000011 Rmu_sc0014162.1_g000009 Rmu_sc0014162.1_g000010 Rmu_sc0016149.1_g000003 Rmu_sc0016418.1_g000008 Rmu_sc0016418.1_g000009 Rmu_sc0017353.1_g000001 Rmu_sc0017353.1_g000002 Rmu_sc0018537.1_g000012 Rmu_sc0019739.1_g000003 Rmu_sc0019739.1_g000004 Rmu_sc0020186.1_g000016 Rmu_sc0021611.1_g000001 Rmu_sc0022755.1_g000003 Rmu_sc0024226.1_g000006 Rmu_sc0025769.1_g000004 Rmu_sc0025769.1_g000005 Rmu_sc0030235.1_g000004 Rmu_sc0035508.1_g000007 Rmu_sc0036413.1_g000001 Rmu_sc0037646.1_g000001 Rmu_sc0037646.1_g000002 Rmu_sc0037647.1_g000001 Rmu_sc0037647.1_g000002 Rmu_sc0037678.1_g000001 Rmu_ssc0000072.1_g000010 Rmu_ssc0000116.1_g000041 Rmu_ssc0000127.1_g000018 Rmu_ssc0000175.1_g000018 Rmu_ssc0000175.1_g000019 Rmu_ssc0000175.1_g000020 Rmu_ssc0000197.1_g000037 Rmu_ssc0000213.1_g000051 Rmu_ssc0000359.1_g000008 Rmu_ssc0000392.1_g000019
rosa_roxburghii Rroxscaffold_154G00447930 Rroxscaffold_1G00000570 Rroxscaffold_1G00009890 Rroxscaffold_1G00012210 Rroxscaffold_1G00012960 Rroxscaffold_1G00014650 Rroxscaffold_1G00014660 Rroxscaffold_1G00014670 Rroxscaffold_1G00022880 Rroxscaffold_1G00024640 Rroxscaffold_1G00024650 Rroxscaffold_1G00025670 Rroxscaffold_1G00025680 Rroxscaffold_1G00025690 Rroxscaffold_1G00030660 Rroxscaffold_1G00031340 Rroxscaffold_1G00031350 Rroxscaffold_2G00103100 Rroxscaffold_2G00103120 Rroxscaffold_2G00107390 Rroxscaffold_2G00108940 Rroxscaffold_2G00110610 Rroxscaffold_2G00110620 Rroxscaffold_2G00110710 Rroxscaffold_2G00110720 Rroxscaffold_2G00110730 Rroxscaffold_2G00111170 Rroxscaffold_2G00111510 Rroxscaffold_2G00114750 Rroxscaffold_2G00114760 Rroxscaffold_2G00114770 Rroxscaffold_2G00116270 Rroxscaffold_2G00121090 Rroxscaffold_2G00129350 Rroxscaffold_2G00130410 Rroxscaffold_2G00155930 Rroxscaffold_3G00218120 Rroxscaffold_3G00218330 Rroxscaffold_3G00218340 Rroxscaffold_3G00227530 Rroxscaffold_3G00233140 Rroxscaffold_3G00236800 Rroxscaffold_3G00242370 Rroxscaffold_3G00242380 Rroxscaffold_3G00242410 Rroxscaffold_3G00248720 Rroxscaffold_3G00248730 Rroxscaffold_3G00248770 Rroxscaffold_3G00258550 Rroxscaffold_3G00258560 Rroxscaffold_4G00287000 Rroxscaffold_4G00289070 Rroxscaffold_4G00289080 Rroxscaffold_4G00289100 Rroxscaffold_4G00295600 Rroxscaffold_4G00298090 Rroxscaffold_4G00308330 Rroxscaffold_4G00310570 Rroxscaffold_4G00310580 Rroxscaffold_4G00310620 Rroxscaffold_4G00315750 Rroxscaffold_4G00319620 Rroxscaffold_4G00319630 Rroxscaffold_4G00328870 Rroxscaffold_4G00328880 Rroxscaffold_4G00332120 Rroxscaffold_4G00332310 Rroxscaffold_5G00332660 Rroxscaffold_5G00332710 Rroxscaffold_5G00332970 Rroxscaffold_5G00344920 Rroxscaffold_5G00345540 Rroxscaffold_5G00346760 Rroxscaffold_5G00346770 Rroxscaffold_5G00347420 Rroxscaffold_5G00350360 Rroxscaffold_5G00350370 Rroxscaffold_5G00354490 Rroxscaffold_5G00370760 Rroxscaffold_5G00370770 Rroxscaffold_5G00374010 Rroxscaffold_5G00374020 Rroxscaffold_5G00374490 Rroxscaffold_5G00374510 Rroxscaffold_5G00387640 Rroxscaffold_5G00387650 Rroxscaffold_6G00387870 Rroxscaffold_6G00388560 Rroxscaffold_6G00388570 Rroxscaffold_6G00388670 Rroxscaffold_6G00388680 Rroxscaffold_6G00391960 Rroxscaffold_6G00393010 Rroxscaffold_6G00395010 Rroxscaffold_6G00395020 Rroxscaffold_6G00397990 Rroxscaffold_6G00401460 Rroxscaffold_6G00407850 Rroxscaffold_6G00423090 Rroxscaffold_6G00423100 Rroxscaffold_6G00423110 Rroxscaffold_7G00165960 Rroxscaffold_7G00165970 Rroxscaffold_7G00176270 Rroxscaffold_7G00176280 Rroxscaffold_7G00176600 Rroxscaffold_7G00176610 Rroxscaffold_7G00176620 Rroxscaffold_7G00176660 Rroxscaffold_7G00195710
rosa_rugosa Rorug03G0209000 Rorug05G0468000 Rorug05G0468000
rosa_samantha Rh3AG250900 Rh3AG257700 Rh3BG294700 Rh3CG284700 Rh3CG284800 Rh3DG280200 Rh3DG280300 Rh3DG280500 Rh3DG287600 Rh3DG287700 Rh4BG408500 Rh4DG402700 Rh6CG194400 Rh6CG194600 Rh6DG186400 Rh6DG186500 Rh7AG218100 Rh7AG278800 Rh7BG224200 Rh7CG231300 Rh7CG231400 Rh7DG225400
rosa_wichuraiana Rw3G022640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 994
AatII GACGTC 1 cut(s) 3165
Acc36I ACCTGC 1 cut(s) 666
AccB1I GGYRCC 2 cut(s) 2891, 4274
AccB7I CCANNNNNTGG 1 cut(s) 1167
AccBSI CCGCTC 1 cut(s) 2673
AccIII TCCGGA 2 cut(s) 327, 3755
AcoI YGGCCR 6 cut(s) 777, 1265, 3400, 3490, 3824, 4012
AcsI RAATTY 4 cut(s) 383, 465, 913, 2661
AcuI CTGAAG 2 cut(s) 3575, 4359
AcvI CACGTG 3 cut(s) 1439, 2312, 2399
AcyI GRCGYC 2 cut(s) 3162, 3889
AdeI CACNNNGTG 1 cut(s) 2402
AfaI GTAC 8 cut(s) 1174, 1197, 1253, 1336, 1693, 2917, 3140, 3353
AflII CTTAAG 1 cut(s) 1586
AflIII ACRYGT 7 cut(s) 1438, 1945, 2156, 2309, 2311, 2396, 4052
AhdI GACNNNNNGTC 1 cut(s) 411
AjiI CACGTC 2 cut(s) 2430, 3398
AleI CACNNNNGTG 1 cut(s) 536
AloI GAACNNNNNNTCC 4 cut(s) 72, 104, 1311, 1343
Alw21I GWGCWC 3 cut(s) 1069, 2848, 4060
Aor13HI TCCGGA 2 cut(s) 327, 3755
ApaI GGGCCC 1 cut(s) 4627
ApoI RAATTY 4 cut(s) 383, 465, 913, 2661
ArsI GACNNNNNNTTYG 4 cut(s) 1400, 1432, 1566, 1598
AseI ATTAAT 1 cut(s) 3384
AsiSI GCGATCGC 1 cut(s) 4960
Asp700I GAANNNNTTC 3 cut(s) 641, 702, 3608
AspA2I CCTAGG 1 cut(s) 2129
AsuC2I CCSGG 9 cut(s) 1005, 2596, 2875, 2876, 3156, 3425, 4627, 4628, 4676
AvrII CCTAGG 1 cut(s) 2129
BaeGI GKGCMC 2 cut(s) 3739, 4627
BaeI ACNNNNGTAYC 4 cut(s) 4026, 4059, 4077, 4110
BalI TGGCCA 3 cut(s) 779, 1267, 4014
BamHI GGATCC 4 cut(s) 312, 600, 2030, 2960
BanI GGYRCC 2 cut(s) 2891, 4274
BanII GRGCYC 3 cut(s) 2870, 3916, 4627
BauI CACGAG 5 cut(s) 2450, 2774, 2798, 2850, 3738
BbrPI CACGTG 3 cut(s) 1439, 2312, 2399
BbsI GAAGAC 2 cut(s) 755, 2153
Bbv12I GWGCWC 3 cut(s) 1069, 2848, 4060
BbvCI CCTCAGC 2 cut(s) 2352, 4547
BceAI ACGGC 2 cut(s) 1007, 3387
BcgI CGANNNNNNTGC 2 cut(s) 1488, 1522
BciVI GTATCC 1 cut(s) 240
BclI TGATCA 1 cut(s) 4879
BcnI CCSGG 9 cut(s) 1005, 2596, 2875, 2876, 3156, 3425, 4627, 4628, 4676
BfmI CTRYAG 3 cut(s) 1831, 4454, 4580
BfoI RGCGCY 1 cut(s) 2823
BfrI CTTAAG 1 cut(s) 1586
BfuAI ACCTGC 1 cut(s) 666
BfuI GTATCC 1 cut(s) 240
BglI GCCNNNNNGGC 4 cut(s) 1040, 3061, 3788, 4916
BglII AGATCT 2 cut(s) 2406, 3852
BlnI CCTAGG 1 cut(s) 2129
BmcAI AGTACT 1 cut(s) 1693
BmeRI GACNNNNNGTC 1 cut(s) 411
BmgBI CACGTC 2 cut(s) 2430, 3398
BmrI ACTGGG 4 cut(s) 1556, 2176, 4115, 4698
BmuI ACTGGG 4 cut(s) 1556, 2176, 4115, 4698
BoxI GACNNNNGTC 1 cut(s) 1961
BpiI GAAGAC 2 cut(s) 755, 2153
BplI GAGNNNNNCTC 8 cut(s) 421, 453, 423, 455, 2948, 2980, 4711, 4743
BpmI CTGGAG 2 cut(s) 437, 3729
Bpu10I CCTNAGC 6 cut(s) 1895, 2352, 3098, 4109, 4368, 4547
BpuEI CTTGAG 5 cut(s) 1053, 1623, 1892, 3227, 3980
BpuMI CCSGG 9 cut(s) 1005, 2596, 2875, 2876, 3156, 3425, 4627, 4628, 4676
Bsa29I ATCGAT 1 cut(s) 105
BsaAI YACGTR 4 cut(s) 1439, 2312, 2399, 4053
BsaHI GRCGYC 2 cut(s) 3162, 3889
BsaI GGTCTC 4 cut(s) 2231, 2641, 4164, 4241
BsaWI WCCGGW 4 cut(s) 327, 956, 2650, 3755
Bse118I RCCGGY 5 cut(s) 165, 250, 2064, 3492, 3988
Bse3DI GCAATG 1 cut(s) 1353
BseAI TCCGGA 2 cut(s) 327, 3755
BseCI ATCGAT 1 cut(s) 105
BseMI GCAATG 1 cut(s) 1353
BsePI GCGCGC 1 cut(s) 4241
BseRI GAGGAG 8 cut(s) 589, 2212, 2231, 2488, 2838, 3131, 3287, 4520
BseSI GKGCMC 2 cut(s) 3739, 4627
BseYI CCCAGC 2 cut(s) 659, 2208
BsgI GTGCAG 2 cut(s) 3426, 4826
Bsh1285I CGRYCG 6 cut(s) 105, 271, 1293, 2814, 4742, 4960
BshNI GGYRCC 2 cut(s) 2891, 4274
BshVI ATCGAT 1 cut(s) 105
BsiEI CGRYCG 6 cut(s) 105, 271, 1293, 2814, 4742, 4960
BsiHKAI GWGCWC 3 cut(s) 1069, 2848, 4060
BsmBI CGTCTC 1 cut(s) 2777
BsmI GAATGC 3 cut(s) 880, 2140, 4652
Bso31I GGTCTC 4 cut(s) 2231, 2641, 4164, 4241
Bsp120I GGGCCC 1 cut(s) 4623
Bsp1286I GDGCHC 7 cut(s) 1069, 2848, 2870, 3739, 3916, 4060, 4627
Bsp13I TCCGGA 2 cut(s) 327, 3755
Bsp19I CCATGG 1 cut(s) 368
Bsp68I TCGCGA 2 cut(s) 2254, 4962
BspDI ATCGAT 1 cut(s) 105
BspEI TCCGGA 2 cut(s) 327, 3755
BspHI TCATGA 1 cut(s) 1813
BspMAI CTGCAG 1 cut(s) 4458
BspMI ACCTGC 1 cut(s) 666
BspQI GCTCTTC 1 cut(s) 1653
BspT107I GGYRCC 2 cut(s) 2891, 4274
BspTI CTTAAG 1 cut(s) 1586
BspTNI GGTCTC 4 cut(s) 2231, 2641, 4164, 4241
BsrBI CCGCTC 1 cut(s) 2673
BsrDI GCAATG 1 cut(s) 1353
BsrFI RCCGGY 5 cut(s) 165, 250, 2064, 3492, 3988
BssAI RCCGGY 5 cut(s) 165, 250, 2064, 3492, 3988
BssHII GCGCGC 1 cut(s) 4241
BssNI GRCGYC 2 cut(s) 3162, 3889
BssSI CACGAG 5 cut(s) 2450, 2774, 2798, 2850, 3738
BssT1I CCWWGG 6 cut(s) 368, 1515, 2129, 2301, 3073, 3360
Bst2BI CACGAG 5 cut(s) 2450, 2774, 2798, 2850, 3738
Bst4CI ACNGT 6 cut(s) 348, 538, 824, 2497, 3937, 4093
Bst6I CTCTTC 3 cut(s) 849, 1653, 3599
BstACI GRCGYC 2 cut(s) 3162, 3889
BstAFI CTTAAG 1 cut(s) 1586
BstBAI YACGTR 4 cut(s) 1439, 2312, 2399, 4053
BstDSI CCRYGG 2 cut(s) 368, 2046
BstEII GGTNACC 2 cut(s) 3667, 3958
BstENI CCTNNNNNAGG 3 cut(s) 2853, 2968, 3923
BstH2I RGCGCY 1 cut(s) 2823
BstMCI CGRYCG 6 cut(s) 105, 271, 1293, 2814, 4742, 4960
BstNSI RCATGY 3 cut(s) 1949, 2160, 4940
BstPAI GACNNNNGTC 1 cut(s) 1961
BstPI GGTNACC 2 cut(s) 3667, 3958
BstSFI CTRYAG 3 cut(s) 1831, 4454, 4580
BstSLI GKGCMC 2 cut(s) 3739, 4627
BstV2I GAAGAC 2 cut(s) 755, 2153
BstX2I RGATCY 9 cut(s) 312, 600, 2030, 2406, 2960, 3418, 3852, 4564, 4777
BstXI CCANNNNNNTGG 2 cut(s) 2012, 3974
BstYI RGATCY 9 cut(s) 312, 600, 2030, 2406, 2960, 3418, 3852, 4564, 4777
Bsu15I ATCGAT 1 cut(s) 105
BsuI GTATCC 1 cut(s) 240
BsuTUI ATCGAT 1 cut(s) 105
BtgI CCRYGG 2 cut(s) 368, 2046
BtgZI GCGATG 3 cut(s) 1991, 3188, 4298
BtrI CACGTC 2 cut(s) 2430, 3398
BtsI GCAGTG 3 cut(s) 408, 2811, 2938
BtuMI TCGCGA 2 cut(s) 2254, 4962
BveI ACCTGC 1 cut(s) 666
CciI TCATGA 1 cut(s) 1813
Cfr10I RCCGGY 5 cut(s) 165, 250, 2064, 3492, 3988
Cfr9I CCCGGG 2 cut(s) 2874, 4626
ClaI ATCGAT 1 cut(s) 105
CseI GACGC 3 cut(s) 202, 2031, 3897
CsiI ACCWGGT 1 cut(s) 174
Csp6I GTAC 8 cut(s) 1173, 1196, 1252, 1335, 1692, 2916, 3139, 3352
CviQI GTAC 8 cut(s) 1173, 1196, 1252, 1335, 1692, 2916, 3139, 3352
DraIII CACNNNGTG 1 cut(s) 2402
DrdI GACNNNNNNGTC 1 cut(s) 994
DriI GACNNNNNGTC 1 cut(s) 411
DseDI GACNNNNNNGTC 1 cut(s) 994
EaeI YGGCCR 6 cut(s) 777, 1265, 3400, 3490, 3824, 4012
Eam1104I CTCTTC 3 cut(s) 849, 1653, 3599
Eam1105I GACNNNNNGTC 1 cut(s) 411
EarI CTCTTC 3 cut(s) 849, 1653, 3599
EciI GGCGGA 4 cut(s) 272, 941, 2485, 3968
Eco130I CCWWGG 6 cut(s) 368, 1515, 2129, 2301, 3073, 3360
Eco147I AGGCCT 1 cut(s) 4823
Eco24I GRGCYC 3 cut(s) 2870, 3916, 4627
Eco31I GGTCTC 4 cut(s) 2231, 2641, 4164, 4241
Eco32I GATATC 1 cut(s) 1327
Eco57I CTGAAG 2 cut(s) 3575, 4359
Eco72I CACGTG 3 cut(s) 1439, 2312, 2399
Eco91I GGTNACC 2 cut(s) 3667, 3958
EcoNI CCTNNNNNAGG 3 cut(s) 2853, 2968, 3923
EcoO65I GGTNACC 2 cut(s) 3667, 3958
EcoRI GAATTC 1 cut(s) 465
EcoRV GATATC 1 cut(s) 1327
EcoT14I CCWWGG 6 cut(s) 368, 1515, 2129, 2301, 3073, 3360
EcoT38I GRGCYC 3 cut(s) 2870, 3916, 4627
ErhI CCWWGG 6 cut(s) 368, 1515, 2129, 2301, 3073, 3360
Esp3I CGTCTC 1 cut(s) 2777
FalI AAGNNNNNCTT 6 cut(s) 626, 658, 1632, 1664, 3596, 3628
FauI CCCGC 5 cut(s) 2753, 2992, 4551, 4578, 4890
FauNDI CATATG 1 cut(s) 4287
FbaI TGATCA 1 cut(s) 4879
FriOI GRGCYC 3 cut(s) 2870, 3916, 4627
GsaI CCCAGC 2 cut(s) 663, 2212
GsuI CTGGAG 2 cut(s) 437, 3729
HaeII RGCGCY 1 cut(s) 2823
HgaI GACGC 3 cut(s) 202, 2031, 3897
Hin1I GRCGYC 2 cut(s) 3162, 3889
HincII GTYRAC 4 cut(s) 1246, 1456, 3255, 3541
HindII GTYRAC 4 cut(s) 1246, 1456, 3255, 3541
Hpy99I CGWCG 7 cut(s) 1028, 2362, 2421, 3678, 3863, 3891, 4518
HpyCH4III ACNGT 6 cut(s) 348, 538, 824, 2497, 3937, 4093
HpyCH4IV ACGT 9 cut(s) 1438, 2311, 2398, 2429, 3162, 3257, 3397, 4052, 4681
HpySE526I ACGT 9 cut(s) 1438, 2311, 2398, 2429, 3162, 3257, 3397, 4052, 4681
Hsp92I GRCGYC 2 cut(s) 3162, 3889
KflI GGGWCCC 3 cut(s) 2974, 3002, 4836
Kpn2I TCCGGA 2 cut(s) 327, 3755
KroI GCCGGC 1 cut(s) 2064
KroNI GCCGGC 1 cut(s) 2066
Ksp22I TGATCA 1 cut(s) 4879
LguI GCTCTTC 1 cut(s) 1653
MabI ACCWGGT 1 cut(s) 174
MaeII ACGT 9 cut(s) 1438, 2311, 2398, 2429, 3162, 3257, 3397, 4052, 4681
MbiI CCGCTC 1 cut(s) 2673
MfeI CAATTG 1 cut(s) 2232
MflI RGATCY 9 cut(s) 312, 600, 2030, 2406, 2960, 3418, 3852, 4564, 4777
MhlI GDGCHC 7 cut(s) 1069, 2848, 2870, 3739, 3916, 4060, 4627
MlsI TGGCCA 3 cut(s) 779, 1267, 4014
MluNI TGGCCA 3 cut(s) 779, 1267, 4014
MlyI GAGTC 8 cut(s) 344, 745, 2209, 4123, 4196, 4272, 4562, 4967
Mox20I TGGCCA 3 cut(s) 779, 1267, 4014
MroI TCCGGA 2 cut(s) 327, 3755
MroNI GCCGGC 1 cut(s) 2064
MroXI GAANNNNTTC 3 cut(s) 641, 702, 3608
MscI TGGCCA 3 cut(s) 779, 1267, 4014
MseI TTAA 6 cut(s) 188, 461, 1299, 1587, 3384, 3648
MslI CAYNNNNRTG 3 cut(s) 227, 536, 906
Msp20I TGGCCA 3 cut(s) 779, 1267, 4014
MspA1I CMGCKG 2 cut(s) 4546, 4585
MspCI CTTAAG 1 cut(s) 1586
MunI CAATTG 1 cut(s) 2232
Mva1269I GAATGC 3 cut(s) 880, 2140, 4652
NaeI GCCGGC 1 cut(s) 2066
NciI CCSGG 9 cut(s) 1005, 2596, 2875, 2876, 3156, 3425, 4627, 4628, 4676
NcoI CCATGG 1 cut(s) 368
NdeI CATATG 1 cut(s) 4287
NgoMIV GCCGGC 1 cut(s) 2064
NmeAIII GCCGAG 2 cut(s) 3802, 4552
NmuCI GTSAC 7 cut(s) 403, 766, 1879, 2305, 3158, 3958, 4264
NruI TCGCGA 2 cut(s) 2254, 4962
NspI RCATGY 3 cut(s) 1949, 2160, 4940
OliI CACNNNNGTG 1 cut(s) 536
PaeR7I CTCGAG 4 cut(s) 1377, 2922, 2946, 4183
PagI TCATGA 1 cut(s) 1813
PasI CCCWGGG 3 cut(s) 3594, 3776, 4249
PauI GCGCGC 1 cut(s) 4241
PceI AGGCCT 1 cut(s) 4823
PciI ACATGT 2 cut(s) 1945, 2156
PciSI GCTCTTC 1 cut(s) 1653
PcsI WCGNNNNNNNCGW 3 cut(s) 1020, 2684, 4211
PctI GAATGC 3 cut(s) 880, 2140, 4652
PdiI GCCGGC 1 cut(s) 2066
PdmI GAANNNNTTC 3 cut(s) 641, 702, 3608
PfeI GAWTC 9 cut(s) 1364, 1591, 1597, 1717, 2256, 2545, 2569, 2711, 4343
PflFI GACNNNGTC 1 cut(s) 4070
PflMI CCANNNNNTGG 1 cut(s) 1167
PfoI TCCNGGA 2 cut(s) 2594, 4674
Ple19I CGATCG 5 cut(s) 105, 271, 2814, 4742, 4960
PleI GAGTC 8 cut(s) 343, 745, 2208, 4122, 4196, 4271, 4561, 4967
PmaCI CACGTG 3 cut(s) 1439, 2312, 2399
PmlI CACGTG 3 cut(s) 1439, 2312, 2399
PpsI GAGTC 8 cut(s) 343, 745, 2208, 4122, 4196, 4271, 4561, 4967
Ppu21I YACGTR 4 cut(s) 1439, 2312, 2399, 4053
PpuMI RGGWCCY 6 cut(s) 421, 987, 2974, 3002, 4005, 4836
PscI ACATGT 2 cut(s) 1945, 2156
PshAI GACNNNNGTC 1 cut(s) 1961
PshBI ATTAAT 1 cut(s) 3384
Psp5II RGGWCCY 6 cut(s) 421, 987, 2974, 3002, 4005, 4836
PspCI CACGTG 3 cut(s) 1439, 2312, 2399
PspEI GGTNACC 2 cut(s) 3667, 3958
PspFI CCCAGC 2 cut(s) 659, 2208
PspOMI GGGCCC 1 cut(s) 4623
PspPPI RGGWCCY 6 cut(s) 421, 987, 2974, 3002, 4005, 4836
PspXI VCTCGAGB 1 cut(s) 1377
PstI CTGCAG 1 cut(s) 4458
PsuI RGATCY 9 cut(s) 312, 600, 2030, 2406, 2960, 3418, 3852, 4564, 4777
PsyI GACNNNGTC 1 cut(s) 4070
PteI GCGCGC 1 cut(s) 4241
PvuI CGATCG 5 cut(s) 105, 271, 2814, 4742, 4960
RgaI GCGATCGC 1 cut(s) 4960
RruI TCGCGA 2 cut(s) 2254, 4962
RsaI GTAC 8 cut(s) 1174, 1197, 1253, 1336, 1693, 2917, 3140, 3353
RsaNI GTAC 8 cut(s) 1173, 1196, 1252, 1335, 1692, 2916, 3139, 3352
RseI CAYNNNNRTG 3 cut(s) 227, 536, 906
SapI GCTCTTC 1 cut(s) 1653
SaqAI TTAA 6 cut(s) 188, 461, 1299, 1587, 3384, 3648
ScaI AGTACT 1 cut(s) 1693
SchI GAGTC 8 cut(s) 344, 745, 2209, 4123, 4196, 4272, 4562, 4967
SduI GDGCHC 7 cut(s) 1069, 2848, 2870, 3739, 3916, 4060, 4627
SexAI ACCWGGT 1 cut(s) 174
SfaAI GCGATCGC 1 cut(s) 4960
SfcI CTRYAG 3 cut(s) 1831, 4454, 4580
Sfr274I CTCGAG 4 cut(s) 1377, 2922, 2946, 4183
SgfI GCGATCGC 1 cut(s) 4960
SlaI CTCGAG 4 cut(s) 1377, 2922, 2946, 4183
SmaI CCCGGG 2 cut(s) 2876, 4628
SmiMI CAYNNNNRTG 3 cut(s) 227, 536, 906
SseBI AGGCCT 1 cut(s) 4823
SspI AATATT 1 cut(s) 3284
StuI AGGCCT 1 cut(s) 4823
StyI CCWWGG 6 cut(s) 368, 1515, 2129, 2301, 3073, 3360
TaaI ACNGT 6 cut(s) 348, 538, 824, 2497, 3937, 4093
TaiI ACGT 9 cut(s) 1441, 2314, 2401, 2432, 3165, 3260, 3400, 4055, 4684
TaqII GACCGA 2 cut(s) 3128, 4779
TatI WGTACW 2 cut(s) 1251, 1691
TauI GCSGC 3 cut(s) 163, 257, 869
TfiI GAWTC 9 cut(s) 1364, 1591, 1597, 1717, 2256, 2545, 2569, 2711, 4343
Tru1I TTAA 6 cut(s) 188, 461, 1299, 1587, 3384, 3648
Tru9I TTAA 6 cut(s) 188, 461, 1299, 1587, 3384, 3648
TseFI GTSAC 7 cut(s) 403, 766, 1879, 2305, 3158, 3958, 4264
Tsp45I GTSAC 7 cut(s) 403, 766, 1879, 2305, 3158, 3958, 4264
TspGWI ACGGA 3 cut(s) 593, 1190, 3847
TspMI CCCGGG 2 cut(s) 2874, 4626
Tth111I GACNNNGTC 1 cut(s) 4070
Van91I CCANNNNNTGG 1 cut(s) 1167
Vha464I CTTAAG 1 cut(s) 1586
VspI ATTAAT 1 cut(s) 3384
XagI CCTNNNNNAGG 3 cut(s) 2853, 2968, 3923
XapI RAATTY 4 cut(s) 383, 465, 913, 2661
XbaI TCTAGA 1 cut(s) 1982
XceI RCATGY 3 cut(s) 1949, 2160, 4940
XcmI CCANNNNNNNNNTGG 3 cut(s) 1006, 4285, 4711
XhoI CTCGAG 4 cut(s) 1377, 2922, 2946, 4183
XmaI CCCGGG 2 cut(s) 2874, 4626
XmaJI CCTAGG 1 cut(s) 2129
XmnI GAANNNNTTC 3 cut(s) 641, 702, 3608
ZraI GACGTC 1 cut(s) 3163
ZrmI AGTACT 1 cut(s) 1693
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.