Rmu_co8460577.1_g000001

protein ubiquitination

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8460577.1
Physical Location & Seq
Forward (+)
1 .. 1698
1698 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8460577.1_g000001.1.cds

Sequence Viewer

Length: 494 bp
gtatacagacacatcccgttgattttaacactcctgagaaacatattactgttgcaaaatcaggagatgaactatatcaacaaaagaaatcagaagatgagcaaggtcatcgtggggatctattttgctcaaaagttgcgtgttgttatagaagacttattaagggtgcacttaaacgtttagggatcaatgatgtatatgacatgaaatcgaaccatgtccgatacaataaacttctagcttgtatgggagaagtgataaaaactatggacgagtttacaccaccagcacaacttaatgttgtgagaaagtcaatcttcaaagctattgaacaagggcatgttgaatttgttactcatatgtgtgaagcaaatccaacactcgtcgtggatatccttgatgaagatgacaagagtatatttcaatatgccattgaatgtcgtcaagaaaaaatttacaatcttatgaaacgtatccccacttccgcctattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

163

Amino Acids

18.78

Weight (kDa)

7.14

Isoelectric Point (pI)

41.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000027)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G18670 AT3G18670 AT3G54065
fragaria_vesca FvH4_1g26570 FvH4_1g26570 FvH4_5g19270 FvH4_5g19273 FvH4_5g35840 FvH4_5g36340 FvH4_5g36630 FvH4_5g37181 FvH4_5g37182 FvH4_5g37185 FvH4_5g37240 FvH4_5g37260 FvH4_6g21440 FvH4_6g44571 FvH4_6g44572 FvH4_6g44610 FvH4_6g44620 FvH4_6g44650 FvH4_6g44660 FvH4_6g45151 FvH4_6g45152 FvH4_6g45152 FvH4_6g45153 FvH4_6g45153 FvH4_6g45153 FvH4_6g45153 FvH4_6g45153 FvH4_6g45154 FvH4_6g51440 FvH4_7g08090 FvH4_7g08090 FvH4_7g08090 FvH4_7g08090 FvH4_7g08090 FvH4_7g08090
malus_domestica MD00G1010300.v1.1 MD00G1010400.v1.1 MD00G1010500.v1.1 MD00G1011000.v1.1 MD00G1011200.v1.1 MD00G1011500.v1.1 MD00G1011900.v1.1 MD03G1133900.v1.1 MD03G1134100.v1.1 MD09G1086300.v1.1 MD09G1086500.v1.1 MD09G1086900.v1.1 MD09G1087000.v1.1 MD09G1088000.v1.1 MD09G1088100.v1.1 MD09G1088200.v1.1 MD09G1088300.v1.1 MD09G1089000.v1.1 MD09G1089300.v1.1 MD09G1133800.v1.1 MD16G1219400.v1.1 MD17G1027900.v1.1 MD17G1028400.v1.1 MD17G1028600.v1.1 MD17G1028700.v1.1 MD17G1028900.v1.1 MD17G1029000.v1.1 MD17G1029100.v1.1 MD17G1029200.v1.1 MD17G1075400.v1.1 MD17G1076000.v1.1 MD17G1077000.v1.1 MD17G1077100.v1.1 MD17G1077800.v1.1 MD17G1078000.v1.1 MD17G1078100.v1.1 MD17G1078300.v1.1 MD17G1100900.v1.1 MD17G1101100.v1.1 MD17G1101400.v1.1 MD17G1104200.v1.1 MD17G1104500.v1.1 MD17G1121300.v1.1 MD17G1121600.v1.1 MD17G1121900.v1.1 MD17G1122700.v1.1 MD17G1218800.v1.1
prunus_persica Prupe.2G033800_v2.0.a1 Prupe.2G033900_v2.0.a1 Prupe.2G080300_v2.0.a1 Prupe.2G080700_v2.0.a1 Prupe.2G080900_v2.0.a1 Prupe.2G081100_v2.0.a1 Prupe.2G081100_v2.0.a1 Prupe.2G081200_v2.0.a1 Prupe.2G081200_v2.0.a1 Prupe.2G081200_v2.0.a1 Prupe.2G081200_v2.0.a1 Prupe.2G081700_v2.0.a1 Prupe.2G081700_v2.0.a1 Prupe.2G082000_v2.0.a1 Prupe.2G082100_v2.0.a1 Prupe.2G082100_v2.0.a1 Prupe.2G082200_v2.0.a1 Prupe.2G082300_v2.0.a1 Prupe.2G082700_v2.0.a1 Prupe.2G082800_v2.0.a1 Prupe.2G082900_v2.0.a1 Prupe.3G235600_v2.0.a1 Prupe.3G236300_v2.0.a1 Prupe.3G236300_v2.0.a1 Prupe.3G236600_v2.0.a1 Prupe.3G236600_v2.0.a1 Prupe.3G236800_v2.0.a1 Prupe.3G237000_v2.0.a1 Prupe.3G237100_v2.0.a1 Prupe.3G237300_v2.0.a1 Prupe.3G237400_v2.0.a1 Prupe.3G237500_v2.0.a1 Prupe.3G237500_v2.0.a1 Prupe.3G237500_v2.0.a1 Prupe.4G282500_v2.0.a1 Prupe.4G282500_v2.0.a1
pyrus_communis pycom03g08990 pycom03g09000 pycom09g01180 pycom09g01190 pycom09g01220 pycom09g01230 pycom09g01360 pycom09g01370 pycom09g01380 pycom09g01410 pycom09g05500 pycom11g10280 pycom11g10290 pycom11g10310 pycom16g18270 pycom16g18280 pycom17g02280 pycom17g02290 pycom17g02300 pycom17g02360 pycom17g02390 pycom17g02410 pycom17g02440 pycom17g02460 pycom17g02470 pycom17g02480 pycom17g02510 pycom17g02530 pycom17g02540 pycom17g02550 pycom17g02560 pycom17g02570 pycom17g02580 pycom17g02630 pycom17g02640 pycom17g04970 pycom17g04980 pycom17g05010 pycom17g07090 pycom17g07620 pycom17g07630 pycom17g07640 pycom17g07650 pycom17g07660 pycom17g07740 pycom17g07760 pycom17g07770 pycom17g09580 pycom17g11170 pycom17g11200 pycom17g11220 pycom17g11240 pycom17g11250 pycom17g11300 pycom17g11340 pycom17g11380 pycom17g11440
rosa_chinensis RchiOBHm_Chr1g0332901 RchiOBHm_Chr1g0338981 RchiOBHm_Chr1g0338991 RchiOBHm_Chr1g0341201 RchiOBHm_Chr1g0341211 RchiOBHm_Chr1g0342721 RchiOBHm_Chr1g0343191 RchiOBHm_Chr2g0146761 RchiOBHm_Chr2g0161791 RchiOBHm_Chr2g0161801 RchiOBHm_Chr2g0161841 RchiOBHm_Chr2g0162041 RchiOBHm_Chr2g0162651 RchiOBHm_Chr2g0162691 RchiOBHm_Chr2g0162701 RchiOBHm_Chr2g0162711 RchiOBHm_Chr2g0162721 RchiOBHm_Chr2g0162811 RchiOBHm_Chr2g0162831 RchiOBHm_Chr2g0162841 RchiOBHm_Chr4g0416381 RchiOBHm_Chr4g0416391 RchiOBHm_Chr5g0075981 RchiOBHm_Chr6g0276101 RchiOBHm_Chr7g0214581 RchiOBHm_Chr7g0214631 RchiOBHm_Chr7g0214651 RchiOBHm_Chr7g0214721 RchiOBHm_Chr7g0223161 RchiOBHm_Chr7g0230661 RchiOBHm_Chr7g0230751 RchiOBHm_Chr7g0230781 RchiOBHm_Chr7g0234581 RchiOBHm_Chr7g0234601 RchiOBHm_Chr7g0237561 RchiOBHm_Chr7g0237571 RchiOBHm_Chr7g0238781 RchiOBHm_Chr7g0238811 RchiOBHm_Chr7g0242161 RchiOBHm_Chr7g0242401 RchiOBHm_Chr7g0242451 RchiOBHm_Chr7g0242921 RchiOBHm_Chr7g0242981 RchiOBHm_Chr7g0243111 RchiOBHm_Chr7g0243251 RchiOBHm_Chr7g0243331
rosa_laevigata RLG00000000803 RLG00000000807 RLG00000000809 RLG00000000811 RLG00000000814 RLG00000000854 RLG00000000859 RLG00000000864 RLG00000000994 RLG00000000995 RLG00000001458 RLG00000001461 RLG00000001474 RLG00000001476 RLG00000002729 RLG00000002730 RLG00000003505 RLG00000008871 RLG00000008873 RLG00000018513 RLG00000021300 RLG00000021303 RLG00000021318 RLG00000021356 RLG00000021357 RLG00000029070 RLG00000029071 RLG00000029171 RLG00000029189 RLG00000029190 RLG00000029640 RLG00000034635
rosa_multiflora Rmu_co8149086.1_g000001 Rmu_co8460577.1_g000001 Rmu_sc0000429.1_g000062 Rmu_sc0000429.1_g000071 Rmu_sc0000429.1_g000081 Rmu_sc0000863.1_g000020 Rmu_sc0001488.1_g000011 Rmu_sc0001545.1_g000007 Rmu_sc0001849.1_g000068 Rmu_sc0001993.1_g000003 Rmu_sc0002222.1_g000002 Rmu_sc0002308.1_g000053 Rmu_sc0002308.1_g000069 Rmu_sc0002480.1_g000007 Rmu_sc0003179.1_g000041 Rmu_sc0004213.1_g000011 Rmu_sc0007101.1_g000012 Rmu_sc0008565.1_g000011 Rmu_sc0009298.1_g000003 Rmu_sc0010407.1_g000009 Rmu_sc0010407.1_g000013 Rmu_sc0026966.1_g000004 Rmu_ssc0000152.1_g000012 Rmu_ssc0000152.1_g000014 Rmu_ssc0000295.1_g000021 Rmu_ssc0000295.1_g000026
rosa_roxburghii Rroxscaffold_1G00029600 Rroxscaffold_2G00087790 Rroxscaffold_2G00087800 Rroxscaffold_2G00088360 Rroxscaffold_2G00088500 Rroxscaffold_2G00088530 Rroxscaffold_2G00088590 Rroxscaffold_3G00221570 Rroxscaffold_3G00222190 Rroxscaffold_3G00222240 Rroxscaffold_3G00222880 Rroxscaffold_3G00222900 Rroxscaffold_3G00223990 Rroxscaffold_3G00229750 Rroxscaffold_3G00229760 Rroxscaffold_3G00245140 Rroxscaffold_3G00245150 Rroxscaffold_3G00245200 Rroxscaffold_3G00253520 Rroxscaffold_3G00253530 Rroxscaffold_4G00294500 Rroxscaffold_4G00311800 Rroxscaffold_4G00311830 Rroxscaffold_4G00311850 Rroxscaffold_4G00313180 Rroxscaffold_4G00313210 Rroxscaffold_4G00316270 Rroxscaffold_4G00317910 Rroxscaffold_4G00317920 Rroxscaffold_5G00349290 Rroxscaffold_5G00349300 Rroxscaffold_5G00349310 Rroxscaffold_5G00351950 Rroxscaffold_5G00351960 Rroxscaffold_5G00353390 Rroxscaffold_7G00192540
rosa_rugosa Rorug01G0102500 Rorug01G0102600 Rorug01G0146400.1 Rorug01G0146500.1 Rorug01G0159400.1 Rorug01G0159500.1 Rorug02G0491900 Rorug02G0492000 Rorug02G0492100 Rorug02G0492200 Rorug02G0492300 Rorug02G0492400 Rorug02G0492500 Rorug02G0492700 Rorug02G0498500 Rorug02G0498600 Rorug02G0498800 Rorug04G0006900 Rorug04G0053700 Rorug06G0002000 Rorug06G0002100 Rorug07G0304700 Rorug07G0304800 Rorug07G0304800 Rorug07G0304800 Rorug07G0305300 Rorug07G0305400 Rorug07G0305500 Rorug07G0305500 Rorug07G0318300 Rorug07G0318600 Rorug07G0323600
rosa_samantha Rh1AG128900 Rh1AG162500 Rh1AG163000 Rh1AG164000 Rh1AG164700 Rh1AG173200 Rh1AG173300 Rh1AG173800 Rh1BG098100 Rh1BG129800 Rh1BG130600 Rh1BG141300 Rh1BG141500 Rh1BG141600 Rh1CG122700 Rh1CG151900 Rh1CG152400 Rh1CG153100 Rh1CG153500 Rh1CG161400 Rh1CG161600 Rh1DG134200 Rh1DG173500 Rh1DG173700 Rh2AG558100 Rh2AG558500 Rh2AG560200 Rh2AG564700 Rh2AG564800 Rh2BG465600 Rh2BG571700 Rh2BG572000 Rh2BG573500 Rh2CG439800 Rh2CG541800 Rh2CG542100 Rh2CG542200 Rh2CG543800 Rh2CG547300 Rh2DG474700 Rh2DG580600 Rh2DG580900 Rh2DG581200 Rh2DG581700 Rh2DG581800 Rh2DG583500 Rh2DG587200 Rh2DG587300 Rh2DG587400 Rh4AG128900 Rh4AG203800 Rh4AG319900 Rh4AG320000 Rh4BG122200 Rh4BG201100 Rh4CG136000 Rh4DG122400 Rh4DG201100 Rh4DG323600 Rh6BG077000 Rh6DG206200 Rh7AG282300 Rh7AG282500 Rh7AG283400 Rh7AG358600 Rh7AG414500 Rh7AG415200 Rh7AG415500 Rh7AG461700 Rh7AG469300 Rh7AG477800 Rh7BG273900 Rh7BG274000 Rh7BG390400 Rh7BG390500 Rh7BG391500 Rh7BG391800 Rh7BG408300 Rh7BG432000 Rh7BG439200 Rh7BG449200 Rh7BG449900 Rh7BG450400 Rh7BG450500 Rh7CG220900 Rh7CG301600 Rh7CG302700 Rh7CG377000 Rh7CG433900 Rh7CG434200 Rh7CG478800 Rh7DG286200 Rh7DG354000 Rh7DG424600 Rh7DG448000 Rh7DG462800 Rh7DG462900
rosa_wichuraiana Rw0G003440 Rw0G011970 Rw0G017120 Rw0G017130 Rw0G017140 Rw0G018470 Rw0G018480 Rw0G020440 Rw1G010470 Rw2G046180 Rw2G046210 Rw2G046230 Rw2G046390 Rw2G046400 Rw2G046710 Rw2G046720 Rw2G046730 Rw3G025310 Rw4G010410 Rw4G017250 Rw6G018270 Rw7G018180 Rw7G024130 Rw7G024160 Rw7G024170 Rw7G034060 Rw7G034250 Rw7G034260 Rw7G034400 Rw7G034410 Rw7G038210 Rw7G039020 Rw7G039060 Rw7G039280 Rw7G039400 Rw7G039470 Rw7G039880 Rw7G039890

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 3
AciI CCGC 1 cut(s) 485
AclI AACGTT 1 cut(s) 177
AclWI GGATC 2 cut(s) 125, 193
AcsI RAATTY 2 cut(s) 346, 452
AgsI TTSAA 5 cut(s) 321, 331, 346, 424, 436
AluBI AGCT 2 cut(s) 241, 325
AluI AGCT 2 cut(s) 241, 325
Alw21I GWGCWC 1 cut(s) 171
Alw44I GTGCAC 1 cut(s) 167
AlwI GGATC 2 cut(s) 125, 193
ApaLI GTGCAC 1 cut(s) 167
ApoI RAATTY 2 cut(s) 346, 452
BaeGI GKGCMC 1 cut(s) 171
BarI GAAGNNNNNNTAC 1 cut(s) 465
BbsI GAAGAC 1 cut(s) 159
Bbv12I GWGCWC 1 cut(s) 171
BcgI CGANNNNNNTGC 2 cut(s) 91, 125
BciVI GTATCC 1 cut(s) 484
BfaI CTAG 1 cut(s) 238
BfuI GTATCC 1 cut(s) 484
BpiI GAAGAC 1 cut(s) 159
BseGI GGATG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 26
BseSI GKGCMC 1 cut(s) 171
BsiHKAI GWGCWC 1 cut(s) 171
Bsp1286I GDGCHC 1 cut(s) 171
Bsp143I GATC 2 cut(s) 117, 185
BspACI CCGC 1 cut(s) 485
BspCNI CTCAG 1 cut(s) 27
BspPI GGATC 2 cut(s) 125, 193
BssMI GATC 2 cut(s) 117, 185
BssNAI GTATAC 1 cut(s) 4
Bst1107I GTATAC 1 cut(s) 4
Bst4CI ACNGT 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 35
BstF5I GGATG 1 cut(s) 12
BstKTI GATC 2 cut(s) 120, 188
BstMBI GATC 2 cut(s) 117, 185
BstNSI RCATGY 1 cut(s) 343
BstSLI GKGCMC 1 cut(s) 171
BstV2I GAAGAC 1 cut(s) 159
BstX2I RGATCY 1 cut(s) 117
BstYI RGATCY 1 cut(s) 117
BstZ17I GTATAC 1 cut(s) 4
BsuI GTATCC 1 cut(s) 484
BtsCI GGATG 1 cut(s) 12
CviAII CATG 3 cut(s) 204, 217, 340
CviJI RGCY 2 cut(s) 241, 325
CviKI_1 RGCY 2 cut(s) 241, 325
DdeI CTNAG 1 cut(s) 35
DpnI GATC 2 cut(s) 119, 187
DpnII GATC 2 cut(s) 117, 185
EciI GGCGGA 1 cut(s) 474
Eco32I GATATC 1 cut(s) 393
EcoRV GATATC 1 cut(s) 393
FaeI CATG 3 cut(s) 207, 220, 343
FalI AAGNNNNNCTT 2 cut(s) 301, 333
FatI CATG 3 cut(s) 203, 216, 339
FauNDI CATATG 1 cut(s) 359
FblI GTMKAC 1 cut(s) 3
FspBI CTAG 1 cut(s) 238
Hin1II CATG 3 cut(s) 207, 220, 343
Hpy166II GTNNAC 3 cut(s) 4, 169, 278
Hpy188I TCNGA 2 cut(s) 93, 223
Hpy188III TCNNGA 3 cut(s) 34, 62, 445
Hpy8I GTNNAC 3 cut(s) 4, 169, 278
Hpy99I CGWCG 1 cut(s) 388
HpyCH4III ACNGT 1 cut(s) 51
HpyCH4IV ACGT 2 cut(s) 177, 471
HpyCH4V TGCA 2 cut(s) 55, 169
HpyF3I CTNAG 1 cut(s) 35
HpySE526I ACGT 2 cut(s) 177, 471
Hsp92II CATG 3 cut(s) 207, 220, 343
Kzo9I GATC 2 cut(s) 117, 185
LpnPI CCDG 3 cut(s) 47, 47, 299
MaeI CTAG 1 cut(s) 238
MaeII ACGT 2 cut(s) 177, 471
MaeIII GTNAC 1 cut(s) 351
MalI GATC 2 cut(s) 119, 187
MboI GATC 2 cut(s) 117, 185
MboII GAAGA 4 cut(s) 106, 164, 309, 415
MflI RGATCY 1 cut(s) 117
MhlI GDGCHC 1 cut(s) 171
MluCI AATT 2 cut(s) 346, 452
MmeI TCCRAC 1 cut(s) 400
MseI TTAA 5 cut(s) 26, 161, 173, 296, 492
MslI CAYNNNNRTG 1 cut(s) 362
NdeI CATATG 1 cut(s) 359
NdeII GATC 2 cut(s) 117, 185
NlaIII CATG 3 cut(s) 207, 220, 343
NspI RCATGY 1 cut(s) 343
Psp1406I AACGTT 1 cut(s) 177
PsuI RGATCY 1 cut(s) 117
RseI CAYNNNNRTG 1 cut(s) 362
SaqAI TTAA 5 cut(s) 26, 161, 173, 296, 492
Sau3AI GATC 2 cut(s) 117, 185
SduI GDGCHC 1 cut(s) 171
SetI ASST 5 cut(s) 108, 180, 243, 327, 474
SmiMI CAYNNNNRTG 1 cut(s) 362
Sse9I AATT 2 cut(s) 346, 452
SsiI CCGC 1 cut(s) 485
SspMI CTAG 1 cut(s) 238
TaaI ACNGT 1 cut(s) 51
TaiI ACGT 2 cut(s) 180, 474
TaqI TCGA 1 cut(s) 211
TasI AATT 2 cut(s) 346, 452
Tru1I TTAA 5 cut(s) 26, 161, 173, 296, 492
Tru9I TTAA 5 cut(s) 26, 161, 173, 296, 492
TspDTI ATGAA 4 cut(s) 83, 220, 416, 481
VneI GTGCAC 1 cut(s) 167
XapI RAATTY 2 cut(s) 346, 452
XceI RCATGY 1 cut(s) 343
XmiI GTMKAC 1 cut(s) 3
XspI CTAG 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.